KIAA0068

Product ID	ORK01053
Accession No	D38549
Description	cytoplasmic FMR1 interacting protein 1, transcript variant 1
Clone name	ha01025
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4379 bp) Predicted protein sequence (1271 aa)
HaloTag ORF Clone	FHC01053
Flexi ORF Clone	FXC01053
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0068 by Kazusa Mouse cDNA Project

Length: 4379 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	562 bp
Genome contig ID	gi51511731f_20344174
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATCGAAAGGTTATAGAAATAAAACTAATGAGATCT
Flanking genome sequence (210871 - 210920)	----+--------+--------+--------+--------+----* ATTTGTGTTCATTTATTTACTCTAACCCTGTGCTGCCTGGCTTGGCAAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	20444174	20555043	31	99.8	Perfect prediction

Length: 1271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L576	100.0	Cytoplasmic FMR...	Homo sapiens
EDL86460	99.2	cytoplasmic FMR...	Rattus norvegicus
Q7TMB8	99.0	Cytoplasmic FMR...	Mus musculus
AAH47135	99.0	Cytoplasmic FMR...	Mus musculus
XP_001790637	99.0	similar to cyto...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032994	0	85.0	KIAA1168

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008081	62	79	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	117	133	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	157	186	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	278	293	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	450	468	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	570	593	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	633	651	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	702	724	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	762	792	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	1098	1122	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	1144	1160	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	1219	1233	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
HMMPfam	IPR008081	19	1271	PF05994	Cytoplasmic fragile X mental retardation protein interacting protein

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTACCAGCCAAATTTCAACAC
Primer_r	TCATGCTAGAGTGGACGGTGG
PCR product length	98 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles