KIAA0063

Product ID	ORK00390
Accession No	D31884
Description	Josephin domain containing 1
Clone name	ha01234
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3168 bp) Predicted protein sequence (211 aa)
HaloTag ORF Clone	FHC00390
Flexi ORF Clone	FXC00390
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0063 by Kazusa Mouse cDNA Project

Length: 3168 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2280 bp
Genome contig ID	gi89161203r_37311573
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTTTGTTTAACCAAATATTAAAAATGGAAAACTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATATGTCTCCTTGTCTGCCTGAATTCTATAATTGTGTAAAGAAAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	37411573	37426217	4	99.2	Perfect prediction

Length: 211 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15040	7.5e-91	100.0	Josephin-1; Jos...	Homo sapiens
Q5BJY4	1.9e-88	97.0	Josephin-1; Jos...	Rattus norvegicus
XP_538372	1.9e-88	97.5	similar to Jose...	Canis lupus fam...
Q9DBJ6	2.2e-88	97.0	Josephin-1; Jos...	Mus musculus
XP_001501689	5.9e-88	97.0	similar to Jose...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006155	34	208	PF02099	Machado-Joseph disease protein MJD
ProfileScan	IPR006155	32	211	PS50957	Machado-Joseph disease protein MJD

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	CTATGAGGACTTGACACAGGT
Primer_r	CTTTATGCTCTGGGTCCTTCA
PCR product length	163 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles