KIAA0082

Product ID	ORK00010
Accession No	D43949
Description	cap methyltransferase 1
Clone name	ha02350
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4018 bp) Predicted protein sequence (882 aa)
HaloTag ORF Clone	FHC00010
Flexi ORF Clone	FXC00010
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0082 by Kazusa Mouse cDNA Project
Note	We replaced ha01325, former representative clones for KIAA0082 with ha02350. (2003/2/07)

Length: 4018 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1367 bp
Genome contig ID	gi89161210f_37408995
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- CTTGGATCATTAAAGATAAACATATTTTTAATGCC
Flanking genome sequence (148273 - 148322)	----+--------+--------+--------+--------+----* TGTGTGGCTCTGTGTTGGGGCTGCTGCTGTTTGTCCTCAGTGCTTTGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	37508995	37557266	24	100.0	Perfect prediction

Length: 882 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001117026	99.9	similar to CG63...	Macaca mulatta
BAF85253	99.9	unnamed protein...	Homo sapiens
AAI33560	95.2	FTSJD2 protein ...	Bos taurus
XP_001117035	95.0	similar to CG63...	Macaca mulatta
Q9DBC3	90.3	FtsJ methyltran...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000467	134	178	PF01585	D111/G-patch
	IPR002877	299	498	PF01728	Ribosomal RNA methyltransferase RrmJ/FtsJ
	IPR001202	801	831	PF00397	WW/Rsp5/WWP
HMMSmart	IPR000467	132	178	SM00443	D111/G-patch
HMMSmart	IPR001202	800	833	SM00456	WW/Rsp5/WWP
ProfileScan	IPR000467	134	180	PS50174	D111/G-patch
ScanRegExp	IPR001202	805	831	PS01159	WW/Rsp5/WWP

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TGTGGGCTCTGCTGTTCTCTC
Primer_r	TGAGTGGGGGAAGGAGACAAG
PCR product length	247 bp
PCR conditions	95 °C15 sec66 °C120 sec30 cycles