KIAA0200

Product ID	ORK00454
Accession No	D83785
Description	mastermind-like transcriptional coactivator 1
Clone name	ha02508
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5713 bp) Predicted protein sequence (1042 aa)
HaloTag ORF Clone	FHC00454
Flexi ORF Clone	FXC00454
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0200 by Kazusa Mouse cDNA Project

Length: 5713 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2399 bp
Genome contig ID	gi51511721f_178992457
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTTTTATCATTATAAAAATAAAGTATTTTGCTAGT
Flanking genome sequence (144428 - 144477)	----+--------+--------+--------+--------+----* ATGGAAACAACCTTTGTATTTGACGTCACCTGGGGTCTGCTGGCAGAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	179092457	179136883	5	99.4	Perfect prediction

Length: 1042 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_527150	98.3	mastermind-like...	Pan troglodytes
Q92585	100.0	Mastermind-like...	Homo sapiens
XP_001105097	96.9	mastermind-like...	Macaca mulatta
AAF34658	99.9	Mam1 [Homo sapi...	Homo sapiens
Q6T264	86.5	Mastermind-like...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058719	2.9e-20	35.5	KIAA1816
AB058722	6e-09	26.6	KIAA1819

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	AGAAGAAAAGGGTGCTCAGAC
Primer_r	GGGCAGTAGAAGAATATGGGG
PCR product length	264 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles