KIAA0194

Product ID	ORK06906
Accession No	D83778
Description	HMG box domain containing 3
Clone name	ha02703
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5245 bp) Predicted protein sequence (1435 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0194 by Kazusa Mouse cDNA Project

Length: 5245 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	935 bp
Genome contig ID	gi51511721f_149260507
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCTCTTCCCCCAACAAGAATAAAGTTTATTAAATT
Flanking genome sequence (152378 - 152427)	----+--------+--------+--------+--------+----* ATCTGGTTTTGGTGTAGCAGGAGTCAATTCCGTGCACATCGTATGGGGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	149360507	149412883	20	99.7	Perfect prediction

Length: 1435 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001714782	100.0	similar to Prot...	Homo sapiens
Q12766	99.9	Protein SMF.	Homo sapiens
XP_001717254	99.9	hypothetical pr...	Homo sapiens
BAG09647	100.0	SMF protein [sy...	synthetic construct
EAW61752	99.9	hCG38618 [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000910	185	243	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR000910	184	254	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR000910	185	243	PS50118	HMG1/2 (high mobility group) box

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CATTTGGGGGAAGCTGAGGAG
Primer_r	TTTCCTTATGGCCCAGTCTGC
PCR product length	250 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles