Gene/Protein Characteristic Table for KIAA0184
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04775
Accession No D80006
Description DIP2 disco-interacting protein 2 homolog A (Drosophila)
Clone name ha02918
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (4639 bp)
Predicted protein sequence (863 aa)
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0184 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4639 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 863 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q14689 0 100.0 Disco-interacti...
Homo sapiens
XP_514951 0 99.8 DIP2-like prote...
Pan troglodytes
EAX09274 0 99.8 DIP2 disco-inte...
Homo sapiens
BAF69070 0 99.9 Dip2 [Homo sapi...
Homo sapiens
EDL31856 0 96.4 mCG141346, isof...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023151 0 81.6 KIAA0934
AB040896 0 77.2 KIAA1463
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000873 310 782 PF00501 AMP-dependent synthetase and ligase
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name Genebridge 4
Primer_f GGCACATTATTTCCCCCTGAG
Primer_r CCCAAGGCCTTTTACAGTCTG
PCR product length 141 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp