KIAA0086

Product ID	ORK00403
Accession No	D42045
Description	DNA cross-link repair 1A, transcript variant 2
Clone name	ha03611
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4468 bp) Predicted protein sequence (1044 aa)
HaloTag ORF Clone	FHC00403
Flexi ORF Clone	FXC00403
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0086 by Kazusa Mouse cDNA Project

Length: 4468 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	427 bp
Genome contig ID	gi89161187r_115484474
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACGTGTATACTTAAATAAAATTAATATAAAATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTCTGGTGTCTTTTGTTTTTTTTGTTTGTTTTTAATAGATTTTATTTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	115584474	115603849	9	100.0	Perfect prediction

Length: 1044 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH13124	100.0	DNA cross-link ...	Homo sapiens
Q6PJP8	99.9	DNA cross-link ...	Homo sapiens
AAH62582	99.8	DNA cross-link ...	Homo sapiens
XP_508045	98.8	DNA-crosslink r...	Pan troglodytes
XP_001090942	93.7	DNA-crosslink r...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011084	923	1021	PF07522	DNA repair metallo-beta-lactamase

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 10

Experimental conditions

Panel name	Genebridge 4
Primer_f	ACAGGATGGACACACTCTAAC
Primer_r	GGTGCCCACATTTACAGTAGG
PCR product length	177 (1.6k) bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles