KIAA0089

Product ID	ORK00011
Accession No	D42047
Description	glycerol-3-phosphate dehydrogenase 1-like
Clone name	ha03662
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4043 bp) Predicted protein sequence (411 aa)
HaloTag ORF Clone	FHC00011
Flexi ORF Clone	FXC00011
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0089 by Kazusa Mouse cDNA Project

Length: 4043 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2806 bp
Genome contig ID	gi89161205f_32023027
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TGATTTAATAAACATTTAACCCCCTAAACTTGGGG
Flanking genome sequence (162184 - 162233)	----+--------+--------+--------+--------+----* CACCGTGGATCCTGTTTTTCTTTTTATCAGCTTAGGTAATCATTTTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	32123027	32185209	8	99.2	Perfect prediction

Length: 411 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001096149	3.3e-143	94.3	similar to glyc...	Macaca mulatta
Q8N335	2.2e-140	100.0	Glycerol-3-phos...	Homo sapiens
Q5R5V3	1.8e-139	99.4	Glycerol-3-phos...	Pongo abelii
2PLA	2e-139	100.0	Crystal structu...	Homo sapiens
AAI49967	7e-137	97.4	GPD1L protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR006109	263	408	PD001278	NAD-dependent glycerol-3-phosphate dehydrogenase
FPrintScan	IPR006168	70	87	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
	IPR006168	132	159	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
	IPR006168	208	228	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
	IPR006168	248	272	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
	IPR006168	273	297	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
	IPR006168	316	333	PR00077	NAD-dependent glycerol-3-phosphate dehydrogenase
HMMPfam	IPR011128	66	237	PF01210	NAD-dependent glycerol-3-phosphate dehydrogenase
HMMPfam	IPR006109	254	404	PF07479	NAD-dependent glycerol-3-phosphate dehydrogenase

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	ACTGAAGAGATTTTGGTGAGG
Primer_r	TCAGAACCAACAATGCCACAG
PCR product length	146 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles