KIAA0228

Product ID	ORK04144
Accession No	D86981
Description	amyloid beta precursor protein (cytoplasmic tail) binding protein 2, transcript variant 1
Clone name	ha04738
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6465 bp) Predicted protein sequence (681 aa)
HaloTag ORF Clone	FHC04144
Flexi ORF Clone	FXC04144
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0228 by Kazusa Mouse cDNA Project

Length: 6465 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4419 bp
Genome contig ID	gi51511734r_55775302
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATGAATTATTGACCTAATAAATATAGTGTTCCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCATAGTGTATCTGTTTCCAATTTGGTTTTGATTGCTTTTGGTTGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	55875302	55958362	13	99.3	Perfect prediction

Length: 681 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001136833	99.7	amyloid beta pr...	Pan troglodytes
EDL15760	90.9	amyloid beta pr...	Mus musculus
Q92624	100.0	Amyloid protein...	Homo sapiens
XP_001918329	99.8	amyloid beta pr...	Equus caballus
Q9DAX9	99.1	Amyloid protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB082531	0.00039	25.2	KIAA2000

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR013026	342	375	SM00028	Tetratricopeptide region
	IPR013026	525	558	SM00028	Tetratricopeptide region
	IPR013026	567	601	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	384	417	PS50005	Tetratricopeptide region
	IPR013026	525	558	PS50005	Tetratricopeptide region
	IPR013026	525	558	PS50293	Tetratricopeptide region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGATCAGCGCTGGGACGGAAC
Primer_r	GCAGGCCCGAGTAAAAAGTGG
PCR product length	103 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles