Order Kazusa clone(s) from : ![]() |
Product ID | ORK00464 |
---|---|
Accession No | D86971 |
Description | La ribonucleoprotein domain family, member 4B |
Clone name | ha04826s1 |
Vector information | |
cDNA sequence | DNA sequence (5640 bp) Predicted protein sequence (751 aa) |
HaloTag ORF Clone |
FHC00464
![]() |
Flexi ORF Clone | FXC00464 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0217
by Kazusa Mouse cDNA Project
|
Note | We replaced ha04826, former representative clones for KIAA0217 with ha04826s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3382 bp |
---|---|
Genome contig ID | gi89161187r_745484 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 845484 | 921702 | 17 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | ACAGGGCTGCAGACAATCGAG |
Primer_r | CATGTAAGCTTGATTCCAGTC |
PCR product length | 127 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |