KIAA0217

Product ID	ORK00464
Accession No	D86971
Description	La ribonucleoprotein domain family, member 4B
Clone name	ha04826s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5640 bp) Predicted protein sequence (751 aa)
HaloTag ORF Clone	FHC00464
Flexi ORF Clone	FXC00464
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0217 by Kazusa Mouse cDNA Project
Note	We replaced ha04826, former representative clones for KIAA0217 with ha04826s1. (2002/5/10)

Length: 5640 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3382 bp
Genome contig ID	gi89161187r_745484
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTAGGTTATGAAAATAAAGATTTAGGCACTGTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTTCTTTTGATTTTTTTTAAATTAAAATTTCTTCAATAATGCATCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	845484	921702	17	99.3	Perfect prediction

Length: 751 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001137313	99.3	La ribonucleopr...	Pan troglodytes
Q92615	100.0	La-related prot...	Homo sapiens
XP_507619	99.3	La ribonucleopr...	Pan troglodytes
EAW86531	96.6	La ribonucleopr...	Homo sapiens
EDM06963	89.0	La ribonucleopr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006630	173	230	PF05383	RNA-binding protein Lupus La
HMMSmart	IPR006630	167	245	SM00715	RNA-binding protein Lupus La
ProfileScan	IPR006630	163	252	PS50961	RNA-binding protein Lupus La

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACAGGGCTGCAGACAATCGAG
Primer_r	CATGTAAGCTTGATTCCAGTC
PCR product length	127 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles