KIAA2019

Product ID	ORK04069
Accession No	AB095939
Description	AHNAK nucleoprotein 2
Clone name	ha06118
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9217 bp) Predicted protein sequence (2797 aa)
Source	Human adult brain

Length: 9217 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	809 bp
Genome contig ID	gi51511730r_104374636
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCCCTGGATGGGCAATAAAGAAAGTGCTGCATCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGCTGAAGGCTGCTGAGGTCTTCTGTCTCAGGGTCGAAGTTTACCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	104474636	104483853	1	99.0	Perfect prediction

Length: 2797 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IVF2	99.9	Protein AHNAK2.	Homo sapiens
XP_001144198	92.2	AHNAK nucleopro...	Pan troglodytes
CAD98019	99.5	hypothetical pr...	Homo sapiens
CAD97904	99.6	hypothetical pr...	Homo sapiens
CAD97981	99.6	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046840	4.5e-05	25.5	KIAA1620

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CAAGGACCAAAACTGAGCACG
Primer_r	AGCAAGCCCCAAGTTACCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-