KIAA1620

Product ID	ORK06502
Accession No	AB046840
Description	periaxin
Clone name	hj04150
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4790 bp) Predicted protein sequence (1398 aa)
Source	Human adult brain
Rouge ID	mKIAA1620 by Kazusa Mouse cDNA Project

Length: 4790 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	200 bp
Genome contig ID	gi42406306r_45491513
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACCAAGCCATGTGAATAAAATAATCTGGAAGTAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATGTATTTGTCTCCTCTGTGTGCATAGGGGGCAGGGAGGGGCAGGAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	45591513	45602035	4	99.2	Perfect prediction

Length: 1398 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW56962	95.2	periaxin, isofo...	Homo sapiens
Q9BXM0	95.2	Periaxin.	Homo sapiens
NP_870998	95.3	periaxin isofor...	Homo sapiens
EAW56963	94.9	periaxin, isofo...	Homo sapiens
AAH68135	75.2	Prx protein [Mu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020652	7.9e-07	28.1	KIAA0845
AB018297	4.6e-06	24.6	KIAA0754
AB095939	0.00043	25.5	KIAA2019

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR004829	455	520	PD153432	Cell surface antigen
	IPR004829	531	594	PD153432	Cell surface antigen
	IPR004829	642	700	PD153432	Cell surface antigen
	IPR004829	730	784	PD153432	Cell surface antigen
HMMPfam	IPR001478	20	69	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	30	102	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	18	87	PS50106	PDZ/DHR/GLGF

Primer_f	TGCAATGCGCCGAGCCTTACA
Primer_r	AAAGGAGAACTCGACGTCAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	RH-map
Primer_f	ACAGCAGGCTACAGGGTTCAG
Primer_r	AAAGACACCCTCACCCACCAG
PCR product length	96 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles