KIAA0283

Product ID	ORK00494
Accession No	AB006621
Description	protein tyrosine phosphatase, receptor type, T, transcript variant 2
Clone name	ha06139s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). This sequence was obtained by subcloning of the DNA fragments derived from two cDNA clones (1 - 4146 was derived from fg01352 and 4147 - 12523 was derived from ha06139). The adjacent sequence to the 5' end of the cDNA is as follows: AAGCTGGTAC GCCTGCAGGT ACCGGTCCGG AATTCCCGGG TCGA-5' end of cDNA.
cDNA sequence	DNA sequence (12523 bp) Predicted protein sequence (1471 aa)
HaloTag ORF Clone	FHC00494
Flexi ORF Clone	FXC00494
Source	Human adult brain
Rouge ID	mKIAA0283 by Kazusa Mouse cDNA Project
Note	We replaced ha06139, former representative clones for KIAA0283 with ha06139s1. (2002/12/27)

Length: 12523 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	8105 bp
Genome contig ID	gi51511747r_40034828
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTTAAAAAATCTATACAATAAAGCTGTGACCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTCATGTTTTCCTAAGATATTCGTACTGGTGTCTTCCTGAGGTTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	40134828	41251879	30	99.3	Internal No-hit

Length: 1471 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI53301	100.0	Protein tyrosin...	Homo sapiens
CAH72554	99.9	protein tyrosin...	Homo sapiens
CAH72555	99.7	protein tyrosin...	Homo sapiens
CAH72559	99.8	protein tyrosin...	Homo sapiens
AAK18742	98.3	brain RPTPmam4 ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002385	6.4e-29	32.4	KIAA0387
AB040904	9.6e-11	28.2	KIAA1471
AB040929	2.5e-10	23.5	KIAA1496
AB023187	6.9e-08	24.7	KIAA0970
AB032958	8.7e-08	22.2	KIAA1132

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000998	104	120	PR00020	MAM
	IPR000998	131	142	PR00020	MAM
	IPR000998	183	197	PR00020	MAM
	IPR000998	202	215	PR00020	MAM
	IPR000242	971	978	PR00700	Protein-tyrosine phosphatase
	IPR000242	987	1007	PR00700	Protein-tyrosine phosphatase
	IPR000242	1070	1087	PR00700	Protein-tyrosine phosphatase
	IPR000242	1109	1127	PR00700	Protein-tyrosine phosphatase
	IPR000242	1140	1155	PR00700	Protein-tyrosine phosphatase
	IPR000242	1156	1166	PR00700	Protein-tyrosine phosphatase
HMMPfam	IPR000998	62	221	PF00629	MAM
	IPR003961	319	404	PF00041	Fibronectin
	IPR003961	532	608	PF00041	Fibronectin
	IPR000242	942	1172	PF00102	Protein-tyrosine phosphatase
	IPR000242	1232	1466	PF00102	Protein-tyrosine phosphatase
HMMSmart	IPR000998	57	221	SM00137	MAM
	IPR003961	318	401	SM00060	Fibronectin
	IPR003961	414	503	SM00060	Fibronectin
	IPR003961	515	605	SM00060	Fibronectin
	IPR000242	918	1175	SM00194	Protein-tyrosine phosphatase
	IPR003595	1071	1172	SM00404	Protein-tyrosine phosphatase
	IPR000242	1204	1469	SM00194	Protein-tyrosine phosphatase
	IPR003595	1361	1466	SM00404	Protein-tyrosine phosphatase
ProfileScan	IPR000998	60	221	PS50060	MAM
	IPR007110	223	314	PS50835	Immunoglobulin-like
	IPR003961	318	409	PS50853	Fibronectin
	IPR003961	416	510	PS50853	Fibronectin
	IPR003961	511	614	PS50853	Fibronectin
	IPR000242	919	1173	PS50055	Protein-tyrosine phosphatase
	IPR000387	1093	1164	PS50056	Protein-tyrosine phosphatase
	IPR000242	1205	1467	PS50055	Protein-tyrosine phosphatase
	IPR000387	1381	1458	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000998	102	141	PS00740	MAM
	IPR000387	1112	1124	PS00383	Protein-tyrosine phosphatase
	IPR000387	1406	1418	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	26	PAAARMASLAALALSLLLRLQLP	48	SECONDARY	23
SOSUI2	2	775	VKMAGVIAGLLMFIIILLGVML	796	PRIMARY	22

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GCTATCCCAAGGTTCCCGCTC
Primer_r	GGCTGCAAAGAGTGTGGAGAC
PCR product length	102 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles