KIAA0292

Product ID	ORK07076
Accession No	AB006630
Description	transcription factor 20 (AR1)
Clone name	ha06353
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6542 bp) Predicted protein sequence (1716 aa)
Source	Human adult brain
Rouge ID	mKIAA0292 by Kazusa Mouse cDNA Project

Length: 6542 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1390 bp
Genome contig ID	gi89161203r_40786026
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAATCAAAAAAATAATAAACTTCATTTTAACCTTG
Flanking genome sequence (99937 - 99888)	----+--------+--------+--------+--------+----* TTTCCTCTTCTGTTTACTTTAAAGTGAATGCGTCTCTTCCTTCTCCCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	40885963	40940524	5	100.0	Perfect prediction

Length: 1716 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UGU0	100.0	Transcription f...	Homo sapiens
EAW60495	100.0	transcription f...	Homo sapiens
EAW60498	99.4	transcription f...	Homo sapiens
EAW60497	100.0	transcription f...	Homo sapiens
XP_515168	99.2	transcription f...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058723	8.7e-14	25.6	KIAA1820

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001965	1642	1689	SM00249	Zinc finger

Primer_f
Primer_r
PCR conditions	test