KIAA0276

Product ID	ORK00489
Accession No	D87466
Description	DCN1, defective in cullin neddylation 1, domain containing 4, transcript variant 1
Clone name	ha06604
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4185 bp) Predicted protein sequence (309 aa)
HaloTag ORF Clone	FHC00489
Flexi ORF Clone	FXC00489
Source	Human adult brain
Rouge ID	mKIAA0276 by Kazusa Mouse cDNA Project

Length: 4185 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3253 bp
Genome contig ID	gi89161207f_52304113
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TCCCATGAATAAAAAGTATTTGTGTTTGGTTTCAG
Flanking genome sequence (173647 - 173696)	----+--------+--------+--------+--------+----* AACAGATGTGTAAATTTTTTCTTCTCTCTTCTGGCTTTCATTTCAAAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	52404113	52477758	11	99.2	Perfect prediction

Length: 309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD97912	9.2e-140	100.0	hypothetical pr...	Homo sapiens
XP_001091219	4.2e-138	99.4	DCN1, defective...	Macaca mulatta
Q92564	2.3e-131	100.0	DCN1-like prote...	Homo sapiens
CAL37607	5.1e-131	99.7	hypothetical pr...	synthetic construct
CAL38118	9.7e-131	99.7	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005176	190	304	PF03556	Protein of unknown function DUF298
ProfileScan	IPR005176	118	304	PS51229	Protein of unknown function DUF298

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGGGGGTTACTGTTCAATGAC
Primer_r	CAGGACTTGCACACTTTTATG
PCR product length	96 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles