KIAA0278

Product ID	ORK00491
Accession No	D87468
Description	activity-regulated cytoskeleton-associated protein
Clone name	ha06634
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2935 bp) Predicted protein sequence (460 aa)
HaloTag ORF Clone	FHC00491
Flexi ORF Clone	FXC00491
Source	Human adult brain
Rouge ID	mKIAA0278 by Kazusa Mouse cDNA Project

Length: 2935 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1551 bp
Genome contig ID	gi51511724r_143589412
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGTAAGATTTTGTTAATAAAACACTGAAACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTGGAGTGTTCATGTTGTTTCTTCTGTGTGCTTGGGCTGGGCAGGGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	143689412	143692815	3	99.0	Terminal No-hit

Length: 460 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001090976	9.6e-154	95.2	similar to acti...	Macaca mulatta
Q7LC44	4.5e-138	100.0	Activity-regula...	Homo sapiens
Q9WV31	3.9e-127	92.9	Activity-regula...	Mus musculus
Q63053	1.3e-126	92.7	Activity-regula...	Rattus norvegicus
AAA68695	2.2e-126	92.4	growth factor.	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 8

Experimental conditions

Panel name	Genebridge 4
Primer_f	GACAAGTCTTCAGCCCACACC
Primer_r	AGGTTTCCAGGGTCTTCACAG
PCR product length	126 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles