KIAA0270

Product ID	ORK06265
Accession No	D87460
Description	paralemmin
Clone name	ha06636
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2552 bp) Predicted protein sequence (345 aa)
Source	Human adult brain
Rouge ID	mKIAA0270 by Kazusa Mouse cDNA Project

Length: 2552 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1514 bp
Genome contig ID	gi42406306f_578562
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCCCAGAGAAGCAAATAAACAGCGTGAACAGCCCC
Flanking genome sequence (120768 - 120817)	----+--------+--------+--------+--------+----* AGTTCCTGGAGTTCTTGCCTTTCAACCTGGCGAGGAAGGCGTGGCCAGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	678555	699328	6	99.0	Terminal No-hit

Length: 345 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75781	6.8e-114	100.0	Paralemmin.	Homo sapiens
CAA76151	1.3e-113	99.7	paralemin [Homo...	Homo sapiens
BAG37611	2.1e-113	99.7	unnamed protein...	Homo sapiens
XP_524021	1e-112	99.1	paralemmin [Pan...	Pan troglodytes
XP_001253885	1.3e-94	83.5	similar to para...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023137	5.1e-05	27.6	KIAA0920

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004965	28	345	PF03285	Paralemmin

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGCCCCCTCTCATTGGAAGTG
Primer_r	TGTCCAAAGCCAACGTGTGAG
PCR product length	117 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles