KIAA0281

Product ID	ORK04883
Accession No	D87457
Description	engulfment and cell motility 1
Clone name	ha06725
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2109 bp) Predicted protein sequence (271 aa)
Source	Human adult brain
Rouge ID	mKIAA0281 by Kazusa Mouse cDNA Project

Length: 2109 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1192 bp
Genome contig ID	gi89161213r_36760492
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTTAAACATGCTGTGGAATAAAATGGATTGTGATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGGGGAGCTGGTGTTTTGATTTAGTAACTTAGGTTCTTGCTACTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	36860492	36992222	7	99.3	Perfect prediction

Length: 271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL32677	8.3e-102	100.0	engulfment and ...	Mus musculus
EDL32680	1.1e-99	94.0	engulfment and ...	Mus musculus
AAH31782	5.3e-99	93.6	Elmo1 protein [...	Mus musculus
BAC86597	5.3e-99	93.6	unnamed protein...	Homo sapiens
EAW94079	6.9e-99	93.6	engulfment and ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058737	4e-73	74.2	KIAA1834

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACTGCCTTCTTCATTTCCACC
Primer_r	GCAACAGTCCGTCCTAGAGGC
PCR product length	122 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles