KIAA0271

Product ID	ORK00485
Accession No	D87461
Description	BCL2-like 2, transcript variant 1
Clone name	ha06752
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3542 bp) Predicted protein sequence (202 aa)
HaloTag ORF Clone	FHC00485
Flexi ORF Clone	FXC00485
Source	Human adult brain
Rouge ID	mKIAA0271 by Kazusa Mouse cDNA Project

Length: 3542 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2784 bp
Genome contig ID	gi51511730f_22745876
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TAAAAACAATAAATAAAGCCCAGAAGTTTAATGAG
Flanking genome sequence (104924 - 104973)	----+--------+--------+--------+--------+----* AAGGACTGAACAGGGTTTGTGACTTCTACACTGTATAGCCTGGGGTCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	22845876	22850798	4	99.0	Terminal No-hit

Length: 202 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABJ16412	2e-80	100.0	BCL2L2 [Felis c...	Felis catus
AAO64470	1.8e-79	98.5	BCL-WEL [Rattus...	Rattus norvegicus
Q92843	2.6e-79	100.0	Apoptosis regul...	Homo sapiens
AAX29811	2.6e-79	100.0	BCL2-like 2 [sy...	synthetic construct
AAV38355	4.9e-79	99.5	BCL2-like 2 [sy...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013280	10	26	PR01865	Apoptosis regulator
	IPR013280	32	42	PR01865	Apoptosis regulator
	IPR013280	44	58	PR01865	Apoptosis regulator
	IPR013280	79	89	PR01865	Apoptosis regulator
	IPR000712	88	100	PR01862	Apoptosis regulator Bcl-2
	IPR000712	101	129	PR01862	Apoptosis regulator Bcl-2
	IPR000712	130	154	PR01862	Apoptosis regulator Bcl-2
	IPR013280	139	154	PR01865	Apoptosis regulator
HMMPfam	IPR003093	15	41	PF02180	Apoptosis regulator Bcl-2 protein
HMMPfam	IPR000712	55	153	PF00452	Apoptosis regulator Bcl-2
HMMSmart	IPR003093	15	41	SM00265	Apoptosis regulator Bcl-2 protein
HMMSmart	IPR000712	55	153	SM00337	Apoptosis regulator Bcl-2
ProfileScan	IPR003093	19	36	PS50063	Apoptosis regulator Bcl-2 protein
ProfileScan	IPR002475	55	155	PS50062	BCL2-like apoptosis inhibitor
ScanRegExp	IPR003093	18	38	PS01260	Apoptosis regulator Bcl-2 protein
	IPR000712	94	113	PS01080	Apoptosis regulator Bcl-2
	IPR000712	146	157	PS01258	Apoptosis regulator Bcl-2

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	95	LFQGGPNWGRLVAFFVFGAALCA	117	SECONDARY	23
SOSUI2	2	177	ASVRTVLTGAVALGALVTVGAFF	199	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AAGTAGGAGGAGAGGGGTTTC
Primer_r	TGTGTGCCCTAGAATAAGTGG
PCR product length	141 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles