Order Kazusa clone(s) from : ![]() |
Product ID | ORK00485 |
---|---|
Accession No | D87461 |
Description | BCL2-like 2, transcript variant 1 |
Clone name | ha06752 |
Vector information | |
cDNA sequence | DNA sequence (3542 bp) Predicted protein sequence (202 aa) |
HaloTag ORF Clone |
FHC00485
![]() |
Flexi ORF Clone | FXC00485 |
Source | Human adult brain |
Rouge ID |
mKIAA0271
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2784 bp |
---|---|
Genome contig ID | gi51511730f_22745876 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (104924 - 104973) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 22845876 | 22850798 | 4 | 99.0 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR013280 | 10 | 26 | PR01865 | Apoptosis regulator |
IPR013280 | 32 | 42 | PR01865 | Apoptosis regulator | |
IPR013280 | 44 | 58 | PR01865 | Apoptosis regulator | |
IPR013280 | 79 | 89 | PR01865 | Apoptosis regulator | |
IPR000712 | 88 | 100 | PR01862 | Apoptosis regulator Bcl-2 | |
IPR000712 | 101 | 129 | PR01862 | Apoptosis regulator Bcl-2 | |
IPR000712 | 130 | 154 | PR01862 | Apoptosis regulator Bcl-2 | |
IPR013280 | 139 | 154 | PR01865 | Apoptosis regulator | |
HMMPfam | IPR003093 | 15 | 41 | PF02180 | Apoptosis regulator Bcl-2 protein |
IPR000712 | 55 | 153 | PF00452 | Apoptosis regulator Bcl-2 | |
HMMSmart | IPR003093 | 15 | 41 | SM00265 | Apoptosis regulator Bcl-2 protein |
IPR000712 | 55 | 153 | SM00337 | Apoptosis regulator Bcl-2 | |
ProfileScan | IPR003093 | 19 | 36 | PS50063 | Apoptosis regulator Bcl-2 protein |
IPR002475 | 55 | 155 | PS50062 | BCL2-like apoptosis inhibitor | |
ScanRegExp | IPR003093 | 18 | 38 | PS01260 | Apoptosis regulator Bcl-2 protein |
IPR000712 | 94 | 113 | PS01080 | Apoptosis regulator Bcl-2 | |
IPR000712 | 146 | 157 | PS01258 | Apoptosis regulator Bcl-2 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 95 | LFQGGPNWGRLVAFFVFGAALCA | 117 | SECONDARY | 23 | 2 | 177 | ASVRTVLTGAVALGALVTVGAFF | 199 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | AAGTAGGAGGAGAGGGGTTTC |
Primer_r | TGTGTGCCCTAGAATAAGTGG |
PCR product length | 141 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |