KIAA0282

Product ID	ORK00493
Accession No	D87458
Description	tripartite motif containing 9
Clone name	ha06845s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4298 bp) Predicted protein sequence (711 aa)
HaloTag ORF Clone	FHC00493
Flexi ORF Clone	FXC00493
Source	Human adult brain
Rouge ID	mKIAA0282 by Kazusa Mouse cDNA Project
Note	We replaced ha06845, former representative clones for KIAA0282 with ha06845s1. (2002/5/10)

Length: 4298 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2162 bp
Genome contig ID	gi51511730r_50411736
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATTTCTGATGTGCCAATAAATGATTTTTATGAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATAAAATGTCTCTAGAATTTCTTAGTTTTTATCTATTGCGGATGACAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	50511736	50631548	10	99.4	Perfect prediction

Length: 711 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001102711	98.8	tripartite moti...	Macaca mulatta
AAG53490	100.0	tripartite moti...	Homo sapiens
AAH63872	100.0	Tripartite moti...	Homo sapiens
AAG53492	99.4	tripartite moti...	Homo sapiens
Q9C026	99.8	Tripartite moti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	57	85	PF00097	Zinc finger
	IPR000315	271	313	PF00643	Zinc finger
	IPR003961	486	572	PF00041	Fibronectin
	IPR003877	623	711	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR001841	57	178	SM00184	Zinc finger
	IPR000315	210	259	SM00336	Zinc finger
	IPR000315	271	313	SM00336	Zinc finger
	IPR003649	320	446	SM00502	B-box
	IPR003961	486	569	SM00060	Fibronectin
ProfileScan	IPR001841	57	94	PS50089	Zinc finger
	IPR000315	210	259	PS50119	Zinc finger
	IPR000315	271	313	PS50119	Zinc finger
	IPR003961	486	579	PS50853	Fibronectin
	IPR001870	564	711	PS50188	B302
ScanRegExp	IPR001841	72	81	PS00518	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGGTGCTATCCTGTTTATGTG
Primer_r	TATGAGTCTACCACGGCCCAG
PCR product length	128 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles