Order Kazusa clone(s) from : ![]() |
Product ID | ORK00475 |
---|---|
Accession No | D87432 |
Description | solute carrier family 7 (amino acid transporter light chain, y+L system), member 6, transcript variant 2 |
Clone name | ha07016 |
Vector information | |
cDNA sequence | DNA sequence (6296 bp) Predicted protein sequence (552 aa) |
HaloTag ORF Clone |
FHC00475
![]() |
Flexi ORF Clone | FXC00475 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0245
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4487 bp |
---|---|
Genome contig ID | gi51511732f_66757995 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (135230 - 135279) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 66857995 | 66893223 | 11 | 99.3 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004841 | 86 | 519 | PF00324 | Amino acid permease-associated region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 83 | SLLNGVSLVVGNMIGSGIFVSPK | 105 | SECONDARY | 23 | 2 | 115 | GMSLIVWAIGGLFSVVGALCYAE | 137 | PRIMARY | 23 | 3 | 159 | FIAFIRLWVSLLVVEPTGQAIIA | 181 | PRIMARY | 23 | 4 | 201 | LACRLLAAACICLLTFVNCAYVK | 223 | PRIMARY | 23 | 5 | 232 | FTYAKVVALIAIIVMGLVKLCQG | 254 | PRIMARY | 23 | 6 | 313 | PIVTLIYILTNVAYYTVLNISDV | 335 | PRIMARY | 23 | 7 | 357 | IPIAVALSCFGGLNASIFASSRL | 379 | SECONDARY | 23 | 8 | 403 | PIPALLFNCTMALIYLIVEDVFQ | 425 | PRIMARY | 23 | 9 | 460 | KLSVFFPIVFCICSVFLVIVPLF | 482 | PRIMARY | 23 | 10 | 486 | INSLIGIGIALSGVPFYFMGVY | 507 | PRIMARY | 22 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | CCTTCACACTGGAGTATTTTG |
Primer_r | TTGCATATTCTTTTGGGGAGG |
PCR product length | 170 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |