Order Kazusa clone(s) from : ![]() |
Product ID | ORK00043 |
---|---|
Accession No | D87743 |
Description | solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6, transcript variant 2 |
Clone name | ha07045 |
Vector information | |
cDNA sequence | DNA sequence (4408 bp) Predicted protein sequence (666 aa) |
HaloTag ORF Clone |
FHC00043
![]() |
Flexi ORF Clone | FXC00043 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0267
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2407 bp |
---|---|
Genome contig ID | gi89161218f_134795337 |
PolyA signal sequence (ATTAAA,-34) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (161623 - 161672) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002090 | 3 | 21 | PR01088 | Na+/H+ exchanger |
IPR002090 | 22 | 40 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 41 | 60 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 61 | 85 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 86 | 104 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 105 | 131 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 133 | 146 | PR01088 | Na+/H+ exchanger | |
IPR004709 | 147 | 158 | PR01084 | Sodium/hydrogen exchanger subfamily | |
IPR004709 | 161 | 175 | PR01084 | Sodium/hydrogen exchanger subfamily | |
IPR004709 | 176 | 184 | PR01084 | Sodium/hydrogen exchanger subfamily | |
IPR004709 | 221 | 231 | PR01084 | Sodium/hydrogen exchanger subfamily | |
IPR002090 | 264 | 281 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 283 | 302 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 494 | 520 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 521 | 539 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 545 | 573 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 574 | 601 | PR01088 | Na+/H+ exchanger | |
IPR002090 | 606 | 627 | PR01088 | Na+/H+ exchanger | |
HMMPfam | IPR006153 | 75 | 500 | PF00999 | Sodium/hydrogen exchanger |
HMMTigr | IPR004709 | 61 | 652 | TIGR00840 | Sodium/hydrogen exchanger subfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 21 | LMRPLWLLLAVGVFDWAGASD | 41 | PRIMARY | 21 | 2 | 70 | NLLIFILLLTLTILTIWLFK | 89 | PRIMARY | 20 | 3 | 97 | HETGLAMIYGLLVGLVLRYGIHV | 119 | PRIMARY | 23 | 4 | 139 | LLVTFDPEVFFNILLPPIIFYAG | 161 | SECONDARY | 23 | 5 | 176 | ILAYAFLGTAISCFVIGSIMYGC | 198 | PRIMARY | 23 | 6 | 216 | DCLLFGAIVSATDPVTVLAIFHE | 238 | SECONDARY | 23 | 7 | 247 | ALLFGESVLNDAVAIVLSSSIVA | 269 | SECONDARY | 23 | 8 | 288 | SIGIFLGIFSGSFAMGAATGVVT | 310 | SECONDARY | 23 | 9 | 331 | FLMSWSTFLLAEAWGFTGVVAVL | 353 | PRIMARY | 23 | 10 | 412 | VGAFVAIFLGRAANIYPLSLLLN | 434 | SECONDARY | 23 | 11 | 480 | LLIVFFTVWVFGGGTTAMLSCLH | 502 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | CATTTATCCTAGTTGTCCGTG |
Primer_r | CCACTATAACATCTGTCCAAG |
PCR product length | 108 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |