KIAA0297

Product ID	ORK05589
Accession No	AB002295
Description	tectonin beta-propeller repeat containing 2
Clone name	hf00325
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8039 bp) Predicted protein sequence (1271 aa)
Source	Human adult brain
Rouge ID	mKIAA0297 by Kazusa Mouse cDNA Project

Length: 8039 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4223 bp
Genome contig ID	gi51511730f_101844650
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TCCAAAAATAAAGCAGATTTACATTTTAAAAATTC
Flanking genome sequence (193922 - 193971)	----+--------+--------+--------+--------+----* AGTTGTCTCTAACTACTCTTTGTTATCAAGGCTGGTTGAGTCAAATATCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	101944650	102038570	17	100.0	Perfect prediction

Length: 1271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_547986	0	84.8	similar to CG11...	Canis lupus fam...
BAE28012	0	80.5	unnamed protein...	Mus musculus
BAG61595	0	98.6	unnamed protein...	Homo sapiens
CAK11071	7.9e-187	51.3	novel protein [...	Danio rerio
CAK11070	9.8e-187	53.9	novel protein [...	Danio rerio

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002327	0	100.0	KIAA0329
AB023234	6.2e-08	30.0	KIAA1017
AB037779	7.4e-06	30.1	KIAA1358

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006624	805	836	PF06462	Beta-propeller repeat TECPR
	IPR006624	854	887	PF06462	Beta-propeller repeat TECPR
	IPR006624	1039	1069	PF06462	Beta-propeller repeat TECPR
	IPR006624	1086	1119	PF06462	Beta-propeller repeat TECPR
	IPR006624	1139	1170	PF06462	Beta-propeller repeat TECPR
	IPR006624	1182	1213	PF06462	Beta-propeller repeat TECPR
HMMSmart	IPR006624	140	174	SM00706	Beta-propeller repeat TECPR
	IPR006624	176	213	SM00706	Beta-propeller repeat TECPR
	IPR006624	745	778	SM00706	Beta-propeller repeat TECPR
	IPR006624	786	821	SM00706	Beta-propeller repeat TECPR
	IPR006624	832	870	SM00706	Beta-propeller repeat TECPR
	IPR006624	1020	1055	SM00706	Beta-propeller repeat TECPR
	IPR006624	1063	1102	SM00706	Beta-propeller repeat TECPR
	IPR006624	1113	1155	SM00706	Beta-propeller repeat TECPR
	IPR006624	1164	1198	SM00706	Beta-propeller repeat TECPR
	IPR006624	1207	1241	SM00706	Beta-propeller repeat TECPR

Primer_f	TTGCTCACGTTAACATGGCTG
Primer_r	CTCAAGAACAAGTCCTAGGTC
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTGCTCACGTTAACATGGCTG
Primer_r	CTCAAGAACAAGTCCTAGGTC
PCR product length	104 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles