KIAA0301

Gene/Protein Characteristic Table for KIAA0301

Order Kazusa clone(s) from :

Product ID	ORK05953
Accession No	AB002299
Description	MDN1, midasin homolog (yeast)
Clone name	hf00402s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a cDNA fragment (1-3733) was subcloned upstream of the cDNA (3734-11140). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA.
cDNA sequence	DNA sequence (11140 bp) Predicted protein sequence (3210 aa)
Source	Human adult brain
Note	We replaced hf00402, former representative clones for KIAA0301 with hf00402s1. (2003/8/28)

Length: 11140 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1506 bp
Genome contig ID	gi89161210r_90308939
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GGAGGCTTATAAAAATAAATTATCCTCCATAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGATGTTGCATCCCACTCACATTTCATTGGCTAAAGCCCTCTATGGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	90408939	90479648	56	99.8	Perfect prediction

Features of the protein sequence

Description

Length: 3210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW48545	100.0	MDN1, midasin h...	Homo sapiens
Q9NU22	100.0	Midasin; MIDAS-...	Homo sapiens
XP_518639	99.3	MDN1, midasin h...	Pan troglodytes
XP_001091687	96.8	MDN1, midasin h...	Macaca mulatta
XP_001915456	87.1	similar to Mida...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR002035	2996	3177	SM00327	von Willebrand factor
ProfileScan	IPR002035	2998	3197	PS50234	von Willebrand factor

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f	CTTATAAGGCTACACCAACTC
Primer_r	GCTAACATGATCCCCTCCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 6

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTTATAAGGCTACACCAACTC
Primer_r	GCTAACATGATCCCCTCCTAC
PCR product length	138 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp