KIAA0319

Product ID	ORK00504
Accession No	AB002317
Description	KIAA0319, transcript variant 1
Clone name	hg00378
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6791 bp) Predicted protein sequence (1109 aa)
HaloTag ORF Clone	FHC00504
Flexi ORF Clone	FXC00504
Source	Human adult brain
Rouge ID	mKIAA0319 by Kazusa Mouse cDNA Project

Length: 6791 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3061 bp
Genome contig ID	gi89161210r_24552469
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGTGTTCATAAATAAAGTTTTATTGGAACATATCC
Flanking genome sequence (99842 - 99793)	----+--------+--------+--------+--------+----* ACATTCACTGATTTATGTATTATCTATGGCTGTTCTTATGTTACAACAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	24652311	24754362	21	99.1	Perfect prediction

Length: 1109 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG59087	0	99.7	unnamed protein...	Homo sapiens
BAG58068	0	99.8	unnamed protein...	Homo sapiens
AAI44629	0	94.0	Unknown (protei...	Homo sapiens
BAE28638	0	75.3	unnamed protein...	Mus musculus
EDL30274	3.5e-162	48.1	expressed seque...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058740	1.1e-82	62.0	KIAA1837

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR011106	57	139	SM00765	Seven cysteines
	IPR003961	342	455	SM00060	Fibronectin
	IPR000601	378	464	SM00089	PKD
	IPR003961	471	549	SM00060	Fibronectin
	IPR000601	472	561	SM00089	PKD
	IPR000601	567	657	SM00089	PKD
	IPR003961	630	739	SM00060	Fibronectin
	IPR000601	658	751	SM00089	PKD
	IPR003961	756	836	SM00060	Fibronectin
	IPR000601	757	848	SM00089	PKD
ProfileScan	IPR013980	50	136	PS50986	Seven cysteines
ProfileScan	IPR000601	582	655	PS50093	PKD

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	37	TMAPPTGVLSSLLLLVTIAGCA	58	PRIMARY	22
SOSUI2	2	994	FYVTVLAFTLIVLTGGFTWLCIC	1016	PRIMARY	23

Primer_f	AGACCCACTTTTCGGCTCATG
Primer_r	TTTATGCTTCAGGGTAGAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGACCCACTTTTCGGCTCATG
Primer_r	TTTATGCTTCAGGGTAGAGGG
PCR product length	97 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles