Order Kazusa clone(s) from : ![]() |
Product ID | ORK05591 |
---|---|
Accession No | AB058740 |
Description | KIAA0319-like |
Clone name | fh22040s1 |
Vector information | |
cDNA sequence | DNA sequence (4423 bp) Predicted protein sequence (639 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1837
by Kazusa Mouse cDNA Project
|
Note | We replaced fh22040, former representative clones for KIAA1837 with fh22040s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 35676730 | 35709095 | 15 | 99.9 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000601 | 254 | 328 | PF00801 | PKD |
IPR000601 | 340 | 425 | PF00801 | PKD | |
HMMSmart | IPR000601 | 52 | 141 | SM00089 | PKD |
IPR000601 | 147 | 237 | SM00089 | PKD | |
IPR000601 | 243 | 331 | SM00089 | PKD | |
IPR000601 | 337 | 428 | SM00089 | PKD | |
ProfileScan | IPR000601 | 166 | 235 | PS50093 | PKD |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 574 | LYVIIATFVIVVALGILSWTVIC | 596 | PRIMARY | 23 |
---|
![]() |
Primer_f | TGGAGAATTTCATCAAGGTGC |
---|---|
Primer_r | TACAACAACAGATCACAGTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | TGGAGAATTTCATCAAGGTGC |
Primer_r | TACAACAACAGATCACAGTCC |
PCR product length | 95 bp |
PCR conditions | 15 °C![]() ![]() ![]() ![]() |