Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05591 |
---|---|
Accession No | AB058740 |
Description | KIAA0319-like |
Clone name | fh22040s1 |
Vector information | |
cDNA sequence | DNA sequence (4423 bp) Predicted protein sequence (639 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1837
by Kazusa Mouse cDNA Project
|
Note | We replaced fh22040, former representative clones for KIAA1837 with fh22040s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 35676730 | 35709095 | 15 | 99.9 | Terminal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000601 | 254 | 328 | PF00801 | PKD |
IPR000601 | 340 | 425 | PF00801 | PKD | |
HMMSmart | IPR000601 | 52 | 141 | SM00089 | PKD |
IPR000601 | 147 | 237 | SM00089 | PKD | |
IPR000601 | 243 | 331 | SM00089 | PKD | |
IPR000601 | 337 | 428 | SM00089 | PKD | |
ProfileScan | IPR000601 | 166 | 235 | PS50093 | PKD |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 574 | LYVIIATFVIVVALGILSWTVIC | 596 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TGGAGAATTTCATCAAGGTGC |
---|---|
Primer_r | TACAACAACAGATCACAGTCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | TGGAGAATTTCATCAAGGTGC |
Primer_r | TACAACAACAGATCACAGTCC |
PCR product length | 95 bp |
PCR conditions | 15 °C62 sec60 °C30 sec135(700) cycles |