Gene/Protein Characteristic Table for KIAA1837
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05591
Accession No AB058740
Description KIAA0319-like
Clone name fh22040s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4423 bp)
Predicted protein sequence (639 aa)
Source Human fetal brain
Rouge ID mKIAA1837 by Kazusa Mouse cDNA Project
Note We replaced fh22040, former representative clones for KIAA1837 with fh22040s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4423 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 r 35676730 35709095 15 99.9 Terminal No-hit
Features of the protein sequence
Description

Length: 639 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB14874 0 100.0 unnamed protein...
Homo sapiens
CAD38985 0 100.0 hypothetical pr...
Homo sapiens
AAL55781 0 100.0 unknown [Homo s...
Homo sapiens
XP_513307 0 100.0 polycystic kidn...
Pan troglodytes
AAN61054 0 100.0 polycystic kidn...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002317 8.8e-133 62.0 KIAA0319
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000601 254 328 PF00801 PKD
IPR000601 340 425 PF00801 PKD
HMMSmart IPR000601 52 141 SM00089 PKD
IPR000601 147 237 SM00089 PKD
IPR000601 243 331 SM00089 PKD
IPR000601 337 428 SM00089 PKD
ProfileScan IPR000601 166 235 PS50093 PKD

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 574 LYVIIATFVIVVALGILSWTVIC 596 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGGAGAATTTCATCAAGGTGC
Primer_r TACAACAACAGATCACAGTCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name CCR
Primer_f TGGAGAATTTCATCAAGGTGC
Primer_r TACAACAACAGATCACAGTCC
PCR product length 95 bp
PCR conditions 15 °C62 sec60 °C30 sec135(700) cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp