KIAA0323

Product ID	ORK00505
Accession No	AB002321
Description	KH and NYN domain containing, transcript variant 2
Clone name	hg00467
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6227 bp) Predicted protein sequence (724 aa)
HaloTag ORF Clone	FHC00505
Flexi ORF Clone	FXC00505
Source	Human adult brain
Rouge ID	mKIAA0323 by Kazusa Mouse cDNA Project

Length: 6227 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4051 bp
Genome contig ID	gi51511730f_23868332
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTGTTGTAAGGAATAAATGATAATAAGCATAAAAC
Flanking genome sequence (112050 - 112099)	----+--------+--------+--------+--------+----* ACTTCAAATAGTGGCTGGTGTGTATAATTGTTTGCAATTACTTGGTCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	23968332	23980380	8	99.1	Perfect prediction

Length: 724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF84369	0	99.9	unnamed protein...	Homo sapiens
CAD61924	0	99.7	unnamed protein...	Homo sapiens
AAI51401	1.8e-204	81.9	LOC100124517 pr...	Bos taurus
EDL36230	4.2e-195	78.3	RIKEN cDNA 9130...	Mus musculus
BAC27665	9.4e-155	78.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037726	1.9e-28	62.6	KIAA1305
AB014515	1.3e-25	30.5	KIAA0615
AB051513	1.1e-16	46.6	KIAA1726

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AGGTCATGGAGAAGTTCAAGG
Primer_r	GTAGTAAGCTGCCGGTGGAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGGTCATGGAGAAGTTCAAGG
Primer_r	GTAGTAAGCTGCCGGTGGAAC
PCR product length	170 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles