Order Kazusa clone(s) from : ![]() |
Product ID | ORK01186 |
---|---|
Accession No | AB067525 |
Description | synaptic Ras GTPase activating protein 1 |
Clone name | hg00912s1 |
Vector information | |
cDNA sequence | DNA sequence (9768 bp) Predicted protein sequence (1376 aa) |
HaloTag ORF Clone |
FHC01186
![]() |
Flexi ORF Clone | FXC01186 |
Source | Human adult brain |
Note | We replaced hg00912, former representative clones for KIAA1938 with hg00912s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 5635 bp |
---|---|
Genome contig ID | gi89161210f_33396013 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (137285 - 137334) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 33495919 | 33533296 | 19 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001849 | 235 | 284 | PF00169 | Pleckstrin-like |
IPR000008 | 297 | 377 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR001936 | 497 | 668 | PF00616 | Ras GTPase-activating protein | |
HMMSmart | IPR001849 | 60 | 286 | SM00233 | Pleckstrin-like |
IPR000008 | 296 | 395 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR001936 | 425 | 762 | SM00323 | Ras GTPase-activating protein | |
ProfileScan | IPR001849 | 250 | 284 | PS50003 | Pleckstrin-like |
IPR001936 | 476 | 668 | PS50018 | Ras GTPase-activating protein | |
ScanRegExp | IPR001936 | 624 | 638 | PS00509 | Ras GTPase-activating protein |
![]() |
Primer_f | AGACACCATCCACATTGAACC |
---|---|
Primer_r | GTGAATCTCCTCCTCGTACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGCTGAAGGCTGGAGAGTAAC |
Primer_r | CACCCCCGATTCCAGTATCTG |
PCR product length | 123 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |