KIAA1938

Product ID	ORK01186
Accession No	AB067525
Description	synaptic Ras GTPase activating protein 1
Clone name	hg00912s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9768 bp) Predicted protein sequence (1376 aa)
HaloTag ORF Clone	FHC01186
Flexi ORF Clone	FXC01186
Source	Human adult brain
Note	We replaced hg00912, former representative clones for KIAA1938 with hg00912s1. (2002/12/27)

Length: 9768 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	5635 bp
Genome contig ID	gi89161210f_33396013
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTTAAAATTTTTTAATAAACTGTGCCCTGAAACCT
Flanking genome sequence (137285 - 137334)	----+--------+--------+--------+--------+----* AAACTGACAGTGGACTGGATTGAGTAATTTGTGTGGGAGAGAATGTGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	33495919	33533296	19	99.4	Perfect prediction

Length: 1376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PV0	100.0	Ras GTPase-acti...	Homo sapiens
AAI48358	100.0	Synaptic Ras GT...	synthetic construct
EDL96865	99.0	synaptic Ras GT...	Rattus norvegicus
EDL96867	99.0	synaptic Ras GT...	Rattus norvegicus
XP_001256820	99.0	synaptic Ras GT...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051530	1.5e-42	49.7	KIAA1743

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	235	284	PF00169	Pleckstrin-like
	IPR000008	297	377	PF00168	C2 calcium-dependent membrane targeting
	IPR001936	497	668	PF00616	Ras GTPase-activating protein
HMMSmart	IPR001849	60	286	SM00233	Pleckstrin-like
	IPR000008	296	395	SM00239	C2 calcium-dependent membrane targeting
	IPR001936	425	762	SM00323	Ras GTPase-activating protein
ProfileScan	IPR001849	250	284	PS50003	Pleckstrin-like
ProfileScan	IPR001936	476	668	PS50018	Ras GTPase-activating protein
ScanRegExp	IPR001936	624	638	PS00509	Ras GTPase-activating protein

Primer_f	AGACACCATCCACATTGAACC
Primer_r	GTGAATCTCCTCCTCGTACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGCTGAAGGCTGGAGAGTAAC
Primer_r	CACCCCCGATTCCAGTATCTG
PCR product length	123 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles