Gene/Protein Characteristic Table for KIAA0602
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00106
Accession No AB011174
Description phosphofurin acidic cluster sorting protein 2, transcript variant 1
Clone name hg01082b
Vector information
The cDNA fragment was inserted at the NotI site of the
cDNA sequence DNA sequence (3428 bp)
Predicted protein sequence (962 aa)
Flexi ORF Clone FXC00106
Source Human adult brain
Rouge ID mKIAA0602 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3428 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 962 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11215 0 100.0 phosphofurin ac...
synthetic construct
XP_001495450 0 93.4 similar to phos...
Equus caballus
NP_001094383 1.9e-201 98.8 phosphofurin ac...
Homo sapiens
Q86VP3 8.7e-199 98.3 Phosphofurin ac...
Homo sapiens
AAQ83882 4e-198 98.2 PACS2 [Homo sap...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033001 9.4e-28 55.5 KIAA1175
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CTAAGAGCCAGTGCATTGAGG
Primer_r GAGTGTCCGAAGATGCAGATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 14
Experimental conditions
Panel name GeneBridge 4
Primer_f GCCTCTGTGTCCTGTCCTTCC
Primer_r CAACTCAGGACAACCCCAACG
PCR product length 129 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp