|
Order Kazusa clone(s) from : |
| Product ID | ORK00106 |
|---|---|
| Accession No | AB011174 |
| Description | phosphofurin acidic cluster sorting protein 2, transcript variant 1 |
| Clone name | hg01082b |
| Vector information | |
| cDNA sequence | DNA sequence (3428 bp) Predicted protein sequence (962 aa) |
|
HaloTag ORF Clone |
FHC00106
|
| Flexi ORF Clone | FXC00106 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0602
by Kazusa Mouse cDNA Project
|
Length: 3428 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 962 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR
|
|---|
Experimental conditions| Primer_f | CTAAGAGCCAGTGCATTGAGG |
|---|---|
| Primer_r | GAGTGTCCGAAGATGCAGATG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 14
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GCCTCTGTGTCCTGTCCTTCC |
| Primer_r | CAACTCAGGACAACCCCAACG |
| PCR product length | 129 bp |
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |