Gene/Protein Characteristic Table for KIAA0401
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05596
Accession No AB007861
Description tet methylcytosine dioxygenase 3
Clone name hg01095
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6454 bp)
Predicted protein sequence (344 aa)
Source Human adult brain
Rouge ID mKIAA0401 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6454 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 344 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O43151 7.6e-90 74.8 Protein TET3.
Homo sapiens
EAW99702 7.8e-90 74.8 hCG40738 [Homo ...
Homo sapiens
XP_515553 1.6e-88 73.7 similar to MGC2...
Pan troglodytes
XP_001107194 6.6e-87 72.0 similar to CXXC...
Macaca mulatta
XP_540225 4.9e-78 66.4 similar to CXXC...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046766 7.5e-07 45.0 KIAA1546
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TAAATCCCCGTGTGAAGAGTG
Primer_r TCCTCATTGGCTTCTATTCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f TAAATCCCCGTGTGAAGAGTG
Primer_r TCCTCATTGGCTTCTATTCTG
PCR product length 121 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp