Gene/Protein Characteristic Table for KIAA0404
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00066
Accession No AB007864
Description autophagy related 2A
Clone name hg01236
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6299 bp)
Predicted protein sequence (1956 aa)
Flexi ORF Clone FXC00066
Source Human adult brain
Rouge ID mKIAA0404 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6299 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1956 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q2TAZ0 0 100.0 Autophagy-relat...
Homo sapiens
AAI10651 0 99.9 ATG2 autophagy ...
Homo sapiens
XP_001114733 0 97.7 similar to Auto...
Macaca mulatta
ACA64880 0 96.0 ATG2 autophagy ...
Callicebus moloch
XP_608267 0 87.3 similar to Auto...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR015412 1853 1950 PF09333 ATG2
ScanRegExp IPR006093 1289 1322 PS00862 Oxygen oxidoreductase covalent FAD-binding site
IPR002328 1894 1908 PS00059 Alcohol dehydrogenase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CCTGGCTCTGCACTTTTCCTC
Primer_r CCCCCAGACACAGAAAGACAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name GeneBridge 4
Primer_f TATTCCACTTCATGCAGACAC
Primer_r AGTGTCTTTCTGTGTCTGGGG
PCR product length 107 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp