| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00091 | 
|---|---|
| Accession No | AB011091 | 
| Description | exostosin-like glycosyltransferase 3, transcript variant 1 | 
| Clone name | hg01237 | 
| Vector information | |
| cDNA sequence | DNA sequence (6189 bp) Predicted protein sequence (931 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00091
     
     
     | 
| Flexi ORF Clone | FXC00091 | 
| Source | Human adult brain | 
| Rouge ID | 
    mKIAA0519
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 6189 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 
        Length: 931 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR004263 | 208 | 524 | PF03016 | Exostosin-like | 
| IPR015338 | 675 | 916 | PF09258 | EXTL2 | 
	Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 41 | LTWLSFTLFVILVFFPLIAHYYL | 63 | PRIMARY | 23 | 
|---|
           
	  RT-PCR
	   | 
	  
	  
|---|
 Experimental conditions| Primer_f | TTTAGTGGAGCCAGGTTGTCG | 
|---|---|
| Primer_r | CCTGCGGCATGTTTTGGTGTC | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 8
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | GCGCACTCCCAGAAAGATCCC | 
| Primer_r | CATAACACCGTCCCAGGGCTC | 
| PCR product length | 140 bp | 
| PCR conditions | 95 °C 15 sec 68 °C 60 sec 30 cycles |