KIAA0340

Product ID	ORK06655
Accession No	AB002338
Description	regulating synaptic membrane exocytosis 1
Clone name	hg01396
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hg01396 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGGC GGACGCGTGG G) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6395 bp) Predicted protein sequence (1053 aa)
Source	Human adult brain
Rouge ID	mKIAA0340 by Kazusa Mouse cDNA Project

Length: 6395 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3231 bp
Genome contig ID	gi89161210f_72553371
PolyA signal sequence (None)	+--------+--------+----*----+---- CTAGATAACAAGAGTGAGACTCTGTCTCAAAAAAG
Flanking genome sequence (490642 - 490691)	----+--------+--------+--------+--------+----* AAAAAAAGAATATTTTCTAGAAATTGAGGAAATTTAAAACATTGATGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	72653371	73044011	21	99.1	Perfect prediction

Length: 1053 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB87121	100.0	RIM short form ...	Homo sapiens
BAB87242	100.0	RIM long form [...	Homo sapiens
AAY96658	99.1	regulating syna...	Macaca mulatta
AAY96657	99.0	regulating syna...	Macaca mulatta
AAB66703	88.7	rab3 effector [...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018294	2.6e-58	56.0	KIAA0751

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	788	800	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	817	830	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	842	850	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR001478	619	702	PF00595	PDZ/DHR/GLGF
HMMPfam	IPR000008	773	864	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001478	628	707	SM00228	PDZ/DHR/GLGF
HMMSmart	IPR000008	772	879	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR010911	47	207	PS50916	Rab-binding
	IPR000306	135	195	PS50178	Zinc finger
	IPR001478	619	705	PS50106	PDZ/DHR/GLGF
	IPR000008	769	864	PS50004	C2 calcium-dependent membrane targeting

Primer_f	CGACAATAAGATAGGGAGTGG
Primer_r	CTCATGTTGTCTCTATCTCCA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTAGTAGAGACGGGGTTTCAC
Primer_r	AGGAGTTGAAAAGAAGAGTCG
PCR product length	170 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles