Order Kazusa clone(s) from : ![]() |
Product ID | ORK01981 |
---|---|
Accession No | AB011168 |
Description | mitogen-activated protein kinase binding protein 1, transcript variant 1 |
Clone name | hg01605 |
Vector information | |
cDNA sequence | DNA sequence (7161 bp) Predicted protein sequence (1531 aa) |
HaloTag ORF Clone |
FHC01981
![]() |
Flexi ORF Clone | FXC01981 |
Source | Human adult brain |
Rouge ID |
mKIAA0596
by Kazusa Mouse cDNA Project
|
Note | We replaced hj02942, former representative clones for KIAA0596 with hg01605. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2420 bp |
---|---|
Genome contig ID | gi51511731f_39754014 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (153331 - 153380) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 39854014 | 39907343 | 31 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 97 | 125 | PF00400 | WD40 repeat |
IPR001680 | 141 | 170 | PF00400 | WD40 repeat | |
IPR001680 | 184 | 221 | PF00400 | WD40 repeat | |
IPR001680 | 302 | 323 | PF00400 | WD40 repeat | |
IPR001680 | 366 | 389 | PF00400 | WD40 repeat | |
IPR001680 | 397 | 444 | PF00400 | WD40 repeat | |
IPR001680 | 486 | 524 | PF00400 | WD40 repeat | |
IPR001680 | 528 | 569 | PF00400 | WD40 repeat | |
IPR001680 | 574 | 614 | PF00400 | WD40 repeat | |
IPR001680 | 668 | 706 | PF00400 | WD40 repeat | |
IPR001680 | 710 | 748 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 96 | 137 | SM00320 | WD40 repeat |
IPR001680 | 140 | 181 | SM00320 | WD40 repeat | |
IPR001680 | 184 | 221 | SM00320 | WD40 repeat | |
IPR001680 | 285 | 323 | SM00320 | WD40 repeat | |
IPR001680 | 354 | 389 | SM00320 | WD40 repeat | |
IPR001680 | 396 | 444 | SM00320 | WD40 repeat | |
IPR001680 | 485 | 524 | SM00320 | WD40 repeat | |
IPR001680 | 527 | 569 | SM00320 | WD40 repeat | |
IPR001680 | 573 | 614 | SM00320 | WD40 repeat | |
IPR001680 | 621 | 661 | SM00320 | WD40 repeat | |
IPR001680 | 664 | 706 | SM00320 | WD40 repeat | |
IPR001680 | 709 | 748 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 103 | 230 | PS50294 | WD40 repeat |
IPR001680 | 357 | 453 | PS50294 | WD40 repeat | |
IPR001680 | 492 | 757 | PS50294 | WD40 repeat | |
IPR001680 | 716 | 757 | PS50082 | WD40 repeat | |
ScanRegExp | IPR002114 | 878 | 893 | PS00589 | Phosphotransferase system |
![]() |
---|
Primer_f | GTAGATGGGACAGGTAAGTGG |
---|---|
Primer_r | CAACTCTTCAACTGCCTCACG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTAGATGGGACAGGTAAGTGG |
Primer_r | CAACTCTTCAACTGCCTCACG |
PCR product length | 136 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |