Gene/Protein Characteristic Table for KIAA0470
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00544
Accession No AB007939
Description centrosomal protein 170kDa, transcript variant gamma
Clone name hg01996
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6456 bp)
Predicted protein sequence (1472 aa)
Flexi ORF Clone FXC00544
Source Human adult brain
Rouge ID mKIAA0470 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1472 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAA83380 0 100.0 KARP-1-binding ...
Homo sapiens
CAI12945 0 99.9 centrosomal pro...
Homo sapiens
XP_514307 0 99.9 centrosomal pro...
Pan troglodytes
XP_001091357 0 98.8 similar to cent...
Macaca mulatta
XP_001090630 0 99.0 similar to cent...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB006622 1.2e-18 32.6 KIAA0284
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000253 35 102 PF00498 Forkhead-associated
HMMSmart IPR000253 34 85 SM00240 Forkhead-associated
ProfileScan IPR000253 35 85 PS50006 Forkhead-associated
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f ACATCCTGGTTTTTGGTGAGC
Primer_r ACACTACGAGACTGCAACATG
PCR product length 107 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp