Order Kazusa clone(s) from : ![]() |
Product ID | ORK00572 |
---|---|
Accession No | AB011176 |
Description | endothelin converting enzyme 2, transcript variant 5 |
Clone name | hg02198b |
Vector information | |
cDNA sequence | DNA sequence (3228 bp) Predicted protein sequence (773 aa) |
HaloTag ORF Clone |
FHC00572
![]() |
Flexi ORF Clone | FXC00572 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000718 | 561 | 573 | PR00786 | Peptidase M13 |
IPR000718 | 579 | 591 | PR00786 | Peptidase M13 | |
IPR000718 | 600 | 616 | PR00786 | Peptidase M13 | |
IPR000718 | 670 | 681 | PR00786 | Peptidase M13 | |
HMMPfam | IPR008753 | 123 | 510 | PF05649 | Peptidase M13 |
IPR000718 | 569 | 772 | PF01431 | Peptidase M13 | |
ScanRegExp | IPR006025 | 607 | 616 | PS00142 | Peptidase M |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 68 | ELVLAGASLLLAALLLGCLVALG | 90 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | GGGGAAGTGCATATGTGTAGC |
---|---|
Primer_r | CCTTTTCCCTGCTCTATCTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGGGAAGTGCATATGTGTAGC |
Primer_r | CCTTTTCCCTGCTCTATCTGC |
PCR product length | 113 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |