KIAA0532

Product ID	ORK00554
Accession No	AB011104
Description	vacuolar protein sorting 13 homolog B (yeast)
Clone name	hg03377
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hg03377 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6827 bp) Predicted protein sequence (1637 aa)
Flexi ORF Clone	FXC00554
Source	Human adult brain
Rouge ID	mKIAA0532 by Kazusa Mouse cDNA Project

Length: 6827 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1913 bp
Genome contig ID	gi51511724f_100748208
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACAGGTTTTGTTATAATAAAGTTACTGATTAAATT
Flanking genome sequence (210777 - 210826)	----+--------+--------+--------+--------+----* AGCTTTGAATAAGTGTCATTTTTTAAAGTTCTCCAGTATCACTTTGCTCG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	100848208	100958983	23	100.0	Perfect prediction

Length: 1637 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE75585	100.0	VPS13B-2A prote...	Homo sapiens
AAP41103	100.0	Cohen syndrome ...	Homo sapiens
CAE75584	100.0	VPS13B-1A prote...	Homo sapiens
Q7Z7G8	100.0	Vacuolar protei...	Homo sapiens
EAW91787	99.9	vacuolar protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023203	4.3e-13	28.8	KIAA0986
AB007922	1.9e-05	21.7	KIAA0453

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR006025	904	913	PS00142	Peptidase M

Primer_f	TCTATGGGTGGTCAGTAATTC
Primer_r	CAACCTCAGAGTAACTATTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTATGGGTGGTCAGTAATTC
Primer_r	CAACCTCAGAGTAACTATTTC
PCR product length	138 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles