KIAA1133

Product ID	ORK00746
Accession No	AB051436
Description	zinc and ring finger 3, transcript variant 2
Clone name	hg03758b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of KpnI site to SacI site of the vector.
cDNA sequence	DNA sequence (6542 bp) Predicted protein sequence (891 aa)
HaloTag ORF Clone	FHC00746
Flexi ORF Clone	FXC00746
Source	Human adult brain
Note	We replaced hh04035, former representative clones for KIAA1133 with hg03758b. (2001/5/29)

Length: 6542 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3866 bp
Genome contig ID	gi89161203f_27509890
PolyA signal sequence (AATACA,-25)	+--------+--------+----*----+---- GTAAAAAAAAAATACAATTTTATCAAGTATGTGTT
Flanking genome sequence (273587 - 273636)	----+--------+--------+--------+--------+----* ATATGTTGTCATTGGTCTGTTCAGTAAAAGTCTGCAGATTCAACAAGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	27609890	27783475	9	99.1	Perfect prediction

Length: 891 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULT6	100.0	Zinc/RING finge...	Homo sapiens
CAG30283	100.0	bK175E3.6 [Homo...	Homo sapiens
BAG53280	99.8	unnamed protein...	Homo sapiens
XP_515054	99.4	zinc and ring f...	Pan troglodytes
XP_001499538	89.6	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033040	5.6e-05	26.1	KIAA1214

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	248	288	PF00097	Zinc finger
HMMSmart	IPR001841	248	288	SM00184	Zinc finger
ProfileScan	IPR001841	248	289	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	173	DMGIFLAFFVVVSLVCLILLVK	194	PRIMARY	22

Primer_f	ACAGCCATATACAGTGAAGAG
Primer_r	TAAGTATGTGAGCAGTGGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-