Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01088 |
---|---|
Accession No | AB011108 |
Description | pre-mRNA processing factor 4B |
Clone name | hg03863 |
Vector information | |
cDNA sequence | DNA sequence (6680 bp) Predicted protein sequence (1028 aa) |
HaloTag ORF Clone |
FHC01088
|
Flexi ORF Clone | FXC01088 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 715 | 933 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 708 | 1024 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 708 | 1022 | SM00219 | Tyrosine protein kinase |
IPR002290 | 708 | 1024 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 708 | 1024 | PS50011 | Protein kinase |
ScanRegExp | IPR008271 | 832 | 844 | PS00108 | Serine/threonine protein kinase |
RT-PCR |
---|
Primer_f | GTTGAGATCTGGAAAGCATAG |
---|---|
Primer_r | GGTGAATATAAGATGCTCCCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTTGAGATCTGGAAAGCATAG |
Primer_r | GGTGAATATAAGATGCTCCCC |
PCR product length | 119 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |