Gene/Protein Characteristic Table for KIAA0536
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01088
Accession No AB011108
Description pre-mRNA processing factor 4B
Clone name hg03863
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6680 bp)
Predicted protein sequence (1028 aa)
Flexi ORF Clone FXC01088
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 6680 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1028 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q13523 0 100.0 Serine/threonin...
Homo sapiens
CAI20480 0 99.9 PRP4 pre-mRNA p...
Homo sapiens
BAF83933 0 99.8 unnamed protein...
Homo sapiens
Q5R814 0 99.7 Serine/threonin...
Pongo abelii
XP_848551 0 98.2 similar to seri...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002322 7.8e-09 28.9 KIAA0324
AB028942 3.7e-06 33.4 KIAA1019
AB058756 5.7e-06 27.0 KIAA1853
AB020641 6.7e-05 29.7 KIAA0834
AB023153 0.00028 26.2 KIAA0936
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 715 933 PD000001 Protein kinase
HMMPfam IPR000719 708 1024 PF00069 Protein kinase
HMMSmart IPR001245 708 1022 SM00219 Tyrosine protein kinase
IPR002290 708 1024 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 708 1024 PS50011 Protein kinase
ScanRegExp IPR008271 832 844 PS00108 Serine/threonine protein kinase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GTTGAGATCTGGAAAGCATAG
Primer_r GGTGAATATAAGATGCTCCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f GTTGAGATCTGGAAAGCATAG
Primer_r GGTGAATATAAGATGCTCCCC
PCR product length 119 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp