KIAA2028

Product ID	ORK00311
Accession No	AB095948
Description	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Clone name	hg04183
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6739 bp) Predicted protein sequence (1449 aa)
Source	Human adult brain
Rouge ID	mKIAA2028 by Kazusa Mouse cDNA Project

Length: 6739 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2388 bp
Genome contig ID	gi89161199f_43659514
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCCCTTTCAGTCATAATAAATGATTTACAAAACCC
Flanking genome sequence (189117 - 189166)	----+--------+--------+--------+--------+----* ATTTTGAGCATTATCTTTTGAATAATCTTCAAGAAATACCTAATGTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	43759514	43848629	28	100.0	Perfect prediction

Length: 1449 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IVE3	100.0	Pleckstrin homo...	Homo sapiens
EAX00293	100.0	hCG2039966, iso...	Homo sapiens
CAI46132	99.8	hypothetical pr...	Homo sapiens
CAL37417	99.6	hypothetical pr...	synthetic construct
XP_525888	99.4	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033026	6e-126	48.5	KIAA1200
AB018342	7.9e-05	21.5	KIAA0799

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	660	753	PF00169	Pleckstrin-like
	IPR001849	768	875	PF00169	Pleckstrin-like
	IPR000857	953	1066	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
HMMSmart	IPR001849	660	755	SM00233	Pleckstrin-like
	IPR001849	768	877	SM00233	Pleckstrin-like
	IPR000857	911	1066	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	1073	1310	SM00295	Band 4.1
ProfileScan	IPR001849	659	753	PS50003	Pleckstrin-like
	IPR001849	767	875	PS50003	Pleckstrin-like
	IPR000857	911	1066	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	1077	1407	PS50057	Band 4.1

Primer_f	AATTTCAATCCCAGAGACTCG
Primer_r	GAATCCTTAACTTTGGGGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-