KIAA0621

Product ID	ORK04156
Accession No	AB014521
Description	Rho GTPase activating protein 26
Clone name	hg04539
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6300 bp) Predicted protein sequence (753 aa)
Source	Human adult brain
Rouge ID	mKIAA0621 by Kazusa Mouse cDNA Project

Length: 6300 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4038 bp
Genome contig ID	gi51511721f_142133178
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCCTGGGTGACAGAGCCAGACTCCGTCTCAAAGG
Flanking genome sequence (453067 - 453116)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGAATGCCATGCCAGGAGAAGACAGCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	142233178	142586243	22	99.3	Perfect prediction

Length: 753 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UNA1	100.0	Rho GTPase-acti...	Homo sapiens
XP_001154330	99.5	similar to olig...	Pan troglodytes
XP_001154393	99.5	similar to olig...	Pan troglodytes
XP_001096464	99.5	GTPase regulato...	Macaca mulatta
XP_535224	97.9	similar to Rho-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26069	1.1e-07	22.9	KIAA0041
AB040911	2.3e-07	31.0	KIAA1478
AB037845	4.1e-07	31.7	KIAA1424
AB018255	6.9e-07	27.0	KIAA0712
AB051509	7.7e-07	28.3	KIAA1722

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	700	751	PD000066	Src homology-3
FPrintScan	IPR001452	712	727	PR00452	Src homology-3
FPrintScan	IPR001452	741	753	PR00452	Src homology-3
HMMPfam	IPR001849	205	308	PF00169	Pleckstrin-like
	IPR000198	330	486	PF00620	RhoGAP
	IPR001452	698	753	PF00018	Src homology-3
HMMSmart	IPR001849	205	310	SM00233	Pleckstrin-like
	IPR000198	326	504	SM00324	RhoGAP
	IPR001452	698	753	SM00326	Src homology-3
ProfileScan	IPR001849	204	308	PS50003	Pleckstrin-like
	IPR000198	322	507	PS50238	RhoGAP
	IPR001452	695	753	PS50002	Src homology-3
ScanRegExp	IPR003006	704	710	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	644	FVWFSVAAVVLSLARSSLHAVFS	666	PRIMARY	23

Primer_f	TATGAGCCAATGAGTAGGAAG
Primer_r	AAAGGAAACTGGAGGCTACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TATGAGCCAATGAGTAGGAAG
Primer_r	AAAGGAAACTGGAGGCTACTG
PCR product length	191 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles