KIAA0623

Product ID	ORK01106
Accession No	AB014523
Description	unc-51 like autophagy activating kinase 2, transcript variant 1
Clone name	hg04615
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5808 bp) Predicted protein sequence (1100 aa)
HaloTag ORF Clone	FHC01106
Flexi ORF Clone	FXC01106
Source	Human adult brain
Rouge ID	mKIAA0623 by Kazusa Mouse cDNA Project

Length: 5808 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2197 bp
Genome contig ID	gi51511734r_19518058
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ATAGCAATAATAAACAAATGCTTTATGTTTCCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTATTTTTAAATTTCATATCGTGTTTCATAGAGTGGAAATGTACCAGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	19618058	19711822	27	99.5	Perfect prediction

Length: 1100 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11220	100.0	serine/threonin...	synthetic construct
Q8IYT8	99.9	Serine/threonin...	Homo sapiens
AAX43266	99.9	unc-51-like kin...	synthetic construct
NP_055498	99.8	unc-51-like kin...	Homo sapiens
XP_511339	99.3	unc-51-like kin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018265	1.5e-71	52.2	KIAA0722
AB051552	3.7e-12	32.1	KIAA1765
D43636	6.7e-11	32.2	KIAA0096
AB002367	2.1e-10	30.9	KIAA0369
AB082526	2.4e-10	33.6	KIAA1995

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	73	327	PD000001	Protein kinase
HMMPfam	IPR000719	73	335	PF00069	Protein kinase
HMMSmart	IPR001245	73	335	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	73	335	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	73	335	PS50011	Protein kinase
ScanRegExp	IPR000719	79	103	PS00107	Protein kinase
ScanRegExp	IPR008271	191	203	PS00108	Serine/threonine protein kinase

Primer_f	AGCTGGGTACATATTAAGTGG
Primer_r	AGGACAAAGGATATTCATGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGCTGGGTACATATTAAGTGG
Primer_r	AGGACAAAGGATATTCATGGC
PCR product length	83 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles