Order Kazusa clone(s) from : ![]() |
Product ID | ORK04711 |
---|---|
Accession No | AB002367 |
Description | doublecortin-like kinase 1 |
Clone name | hh00177 |
Vector information | |
cDNA sequence | DNA sequence (5703 bp) Predicted protein sequence (794 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0369
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 455 | 711 | PD000001 | Protein kinase |
HMMPfam | IPR003533 | 139 | 203 | PF03607 | Doublecortin |
IPR003533 | 268 | 329 | PF03607 | Doublecortin | |
IPR000719 | 455 | 712 | PF00069 | Protein kinase | |
HMMSmart | IPR003533 | 117 | 208 | SM00537 | Doublecortin |
IPR003533 | 246 | 334 | SM00537 | Doublecortin | |
IPR001245 | 455 | 710 | SM00219 | Tyrosine protein kinase | |
IPR002290 | 455 | 712 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR003533 | 122 | 208 | PS50309 | Doublecortin |
IPR003533 | 251 | 334 | PS50309 | Doublecortin | |
IPR000719 | 455 | 712 | PS50011 | Protein kinase | |
ScanRegExp | IPR000719 | 461 | 488 | PS00107 | Protein kinase |
IPR008271 | 572 | 584 | PS00108 | Serine/threonine protein kinase |
![]() |
---|
Primer_f | ACGTGTAAGTTAGATGAGGGC |
---|---|
Primer_r | GCATCGTGTAAATCATCTCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACGTGTAAGTTAGATGAGGGC |
Primer_r | GCATCGTGTAAATCATCTCTG |
PCR product length | 189 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |