KIAA0968

Product ID	ORK00158
Accession No	AB023185
Description	calcium/calmodulin-dependent protein kinase II alpha, transcript variant 2
Clone name	hj06483
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4797 bp) Predicted protein sequence (527 aa)
HaloTag ORF Clone	FHC00158
Flexi ORF Clone	FXC00158
Source	Human adult brain
Rouge ID	mKIAA0968 by Kazusa Mouse cDNA Project

Length: 4797 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3212 bp
Genome contig ID	gi51511721r_149479253
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGGTGTTTTCAGTGCAATAAATAGCTACAAACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTGCACTCTGTGTGTCCCTGTCTTGGTCAAGCCCCTGAGCTGGGAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	149579253	149649529	18	99.3	Perfect prediction

Length: 527 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5RCC4	5e-198	100.0	Calcium/calmodu...	Pongo abelii
CAI65266	8e-198	96.4	EGFP-CaMKII fus...	Cloning vector ...
P11275	9e-198	99.8	Calcium/calmodu...	Rattus norvegicus
AAX22059	1e-197	99.2	Camuialpha [syn...	synthetic construct
AAH40457	1e-197	99.8	Calcium/calmodu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002367	1.2e-40	38.9	KIAA0369
AB051552	1.3e-39	39.7	KIAA1765
AB058763	1.6e-31	35.2	KIAA1860
D43636	1.8e-30	37.9	KIAA0096
AB023216	6.1e-30	32.0	KIAA0999

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	62	319	PD000001	Protein kinase
HMMPfam	IPR000719	62	320	PF00069	Protein kinase
HMMPfam	IPR013543	395	522	PF08332	Calcium/calmodulin dependent protein kinase II
HMMSmart	IPR001245	62	320	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	62	320	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	62	320	PS50011	Protein kinase
ScanRegExp	IPR000719	68	91	PS00107	Protein kinase
ScanRegExp	IPR008271	180	192	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	243	VDLWACGVILYILLVGYPPFWDE	265	PRIMARY	23

Primer_f	TCAGCCTCAGTTCCCTCATTG
Primer_r	AGAAGTAAACAGGAGTCCAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-