Gene/Protein Characteristic Table for KIAA0366
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01075
Accession No AB002364
Description ADAM metallopeptidase with thrombospondin type 1 motif, 3
Clone name hh00124
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5774 bp)
Predicted protein sequence (1201 aa)
Flexi ORF Clone FXC01075
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 5774 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1201 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15072 0 100.0 A disintegrin a...
Homo sapiens
AAI30288 0 99.9 ADAM metallopep...
Homo sapiens
XP_517240 0 99.5 ADAM metallopep...
Pan troglodytes
XP_001158398 0 98.3 ADAM metallopep...
Pan troglodytes
XP_001104686 0 97.3 similar to ADAM...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037733 1.4e-70 32.5 KIAA1312
AB037767 3.1e-64 31.6 KIAA1346
AB095949 5.4e-61 33.8 KIAA2029
AB014588 8.4e-50 31.4 KIAA0688
AB011177 4.3e-23 25.1 KIAA0605
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR013273 556 574 PR01857 Peptidase M12B
IPR013273 669 688 PR01857 Peptidase M12B
IPR013273 689 708 PR01857 Peptidase M12B
HMMPfam IPR002870 3 197 PF01562 Peptidase M12B
IPR001590 254 456 PF01421 Peptidase M12B
IPR000884 551 601 PF00090 Thrombospondin
IPR010294 709 823 PF05986 ADAM-TS Spacer 1
IPR000884 843 900 PF00090 Thrombospondin
IPR000884 905 962 PF00090 Thrombospondin
IPR000884 966 1011 PF00090 Thrombospondin
HMMSmart IPR000884 550 602 SM00209 Thrombospondin
IPR000884 844 901 SM00209 Thrombospondin
IPR000884 904 963 SM00209 Thrombospondin
IPR000884 965 1012 SM00209 Thrombospondin
ProfileScan IPR001590 252 456 PS50215 Peptidase M12B
IPR000884 547 602 PS50092 Thrombospondin
IPR000884 841 901 PS50092 Thrombospondin
IPR000884 902 961 PS50092 Thrombospondin
IPR000884 962 1012 PS50092 Thrombospondin
IPR010909 1007 1050 PS50900 PLAC

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 291 ESLGVHINVVLVRMIMLGYAKSI 313 PRIMARY 23
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TTTATTGGTACGTGCTCTCAG
Primer_r GGAAGATAAAGATGGTCACAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f TTTATTGGTACGTGCTCTCAG
Primer_r GGAAGATAAAGATGGTCACAC
PCR product length 159 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp