Gene/Protein Characteristic Table for KIAA0414
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00530
Accession No AB007874
Description zinc finger and BTB domain containing 43, transcript variant 1
Clone name hh00161
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5725 bp)
Predicted protein sequence (492 aa)
Flexi ORF Clone FXC00530
Source Human adult brain
Rouge ID mKIAA0414 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5725 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 492 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_851640 5.6e-195 98.7 similar to Zinc...
Canis lupus fam...
O43298 8.8e-194 100.0 Zinc finger and...
Homo sapiens
AAP36973 8.8e-194 100.0 zinc finger pro...
synthetic construct
XP_001097208 1.4e-192 99.4 zinc finger pro...
Macaca mulatta
XP_001501808 1.3e-191 98.7 similar to Zinc...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB082524 1.4e-20 30.3 KIAA1993
AB046792 4.5e-09 27.1 KIAA1572
AB058777 8.2e-08 28.3 KIAA1874
AB075836 3.2e-07 26.4 KIAA1956
AB033016 3.9e-07 38.0 KIAA1190
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 425 448 PD000003 Zinc finger
HMMPfam IPR013069 48 152 PF00651 BTB/POZ
IPR007087 398 419 PF00096 Zinc finger
IPR007087 425 447 PF00096 Zinc finger
IPR007087 453 475 PF00096 Zinc finger
HMMSmart IPR000210 58 152 SM00225 BTB/POZ-like
IPR015880 398 419 SM00355 Zinc finger
IPR015880 425 447 SM00355 Zinc finger
IPR015880 453 473 SM00355 Zinc finger
ProfileScan IPR000210 58 122 PS50097 BTB/POZ-like
IPR007087 398 424 PS50157 Zinc finger
IPR007087 425 452 PS50157 Zinc finger
IPR007087 453 482 PS50157 Zinc finger
ScanRegExp IPR007087 427 447 PS00028 Zinc finger

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 4 IFGLEFVLIFLSLVAPNKICDEM 26 PRIMARY 23
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CATGGGGATTGAAGAAAAACC
Primer_r CACGTCAATGGCCTACAAACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name GeneBridge 4
Primer_f CATGGGGATTGAAGAAAAACC
Primer_r CACGTCAATGGCCTACAAACC
PCR product length 102 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp