Gene/Protein Characteristic Table for KIAA1874
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00939
Accession No AB058777
Description zinc finger protein 286A, transcript variant 1
Clone name hk07257s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4262 bp)
Predicted protein sequence (579 aa)
Flexi ORF Clone FXC00939
Source Human adult brain
Rouge ID mKIAA1874 by Kazusa Mouse cDNA Project
Note We replaced hk07257, former representative clones for KIAA1874 with hk07257s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4262 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 2377 bp
Genome contig ID gi51511734f_15443780
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
GGTGTAAATATGTTGGTAATAAAATCTCCAACCAC
Flanking genome sequence
(145039 - 145088)		 
----+----*----+----*----+----*----+----*----+----*
AGCATAGTCATGGGAATGTTTTTGTTACAATTTTTGTTCTCAAGGTTATA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 f 15543780 15588817 17 99.3 Perfect prediction
Ensembl gnome browser 17 r 16722504 18526278 15 96.3 Internal No-hit
Features of the protein sequence
Description

Length: 579 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10170 8.7e-213 100.0 zinc finger pro...
 synthetic construct
Q9HBT8 2.7e-212 99.8 Zinc finger pro...
 Homo sapiens
BAG37536 4.8e-212 99.6 unnamed protein...
 Homo sapiens
XP_001169558 3.4e-211 99.2 zinc finger pro...
 Pan troglodytes
XP_001085916 4e-208 97.7 similar to zinc...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D31763 1.4e-55 52.2 KIAA0065
AB058732 6.1e-55 43.9 KIAA1829
AB058755 1.5e-54 38.2 KIAA1852
AB014528 7.3e-54 54.5 KIAA0628
AB046831 1e-53 44.5 KIAA1611
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 301 324 PD000003 Zinc finger
IPR007087 329 352 PD000003 Zinc finger
IPR007087 356 378 PD000003 Zinc finger
IPR007087 384 407 PD000003 Zinc finger
IPR007087 412 435 PD000003 Zinc finger
IPR007087 440 463 PD000003 Zinc finger
IPR007087 468 491 PD000003 Zinc finger
IPR007087 496 518 PD000003 Zinc finger
IPR007087 524 547 PD000003 Zinc finger
IPR007087 552 575 PD000003 Zinc finger
HMMPfam IPR001909 103 139 PF01352 KRAB box
IPR007087 301 323 PF00096 Zinc finger
IPR007087 329 351 PF00096 Zinc finger
IPR007087 356 378 PF00096 Zinc finger
IPR007087 384 406 PF00096 Zinc finger
IPR007087 412 434 PF00096 Zinc finger
IPR007087 440 462 PF00096 Zinc finger
IPR007087 468 490 PF00096 Zinc finger
IPR007087 496 518 PF00096 Zinc finger
IPR007087 524 546 PF00096 Zinc finger
IPR007087 552 574 PF00096 Zinc finger
HMMSmart IPR001909 103 158 SM00349 KRAB box
IPR015880 301 323 SM00355 Zinc finger
IPR015880 329 351 SM00355 Zinc finger
IPR015880 356 378 SM00355 Zinc finger
IPR015880 384 406 SM00355 Zinc finger
IPR015880 412 434 SM00355 Zinc finger
IPR015880 440 462 SM00355 Zinc finger
IPR015880 468 490 SM00355 Zinc finger
IPR015880 496 518 SM00355 Zinc finger
IPR015880 524 546 SM00355 Zinc finger
IPR015880 552 574 SM00355 Zinc finger
ProfileScan IPR001909 103 169 PS50805 KRAB box
IPR007087 301 328 PS50157 Zinc finger
IPR007087 329 352 PS50157 Zinc finger
IPR007087 356 383 PS50157 Zinc finger
IPR007087 384 411 PS50157 Zinc finger
IPR007087 412 439 PS50157 Zinc finger
IPR007087 440 467 PS50157 Zinc finger
IPR007087 468 495 PS50157 Zinc finger
IPR007087 496 523 PS50157 Zinc finger
IPR007087 524 551 PS50157 Zinc finger
IPR007087 552 579 PS50157 Zinc finger
ScanRegExp IPR007087 303 323 PS00028 Zinc finger
IPR007087 331 351 PS00028 Zinc finger
IPR007087 358 378 PS00028 Zinc finger
IPR007087 386 406 PS00028 Zinc finger
IPR007087 414 434 PS00028 Zinc finger
IPR007087 442 462 PS00028 Zinc finger
IPR007087 470 490 PS00028 Zinc finger
IPR007087 498 518 PS00028 Zinc finger
IPR007087 526 546 PS00028 Zinc finger
IPR007087 554 574 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AAGCAGCAGGAATTATGTGAC
Primer_r TCTCGAGCCAGGCAGTATTTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f CCTCCGGTGTTTCCTTGATGG
Primer_r TGCACCATGGCTGTCAGTACC
PCR product length 95 bp
PCR conditions 15 °C66 sec60 °C30 sec99(500) cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp