Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01987 |
---|---|
Accession No | AB014528 |
Description | zinc finger protein 623, transcript variant 1 |
Clone name | hh01433 |
Vector information | |
cDNA sequence | DNA sequence (5871 bp) Predicted protein sequence (540 aa) |
HaloTag ORF Clone |
FHC01987
|
Flexi ORF Clone | FXC01987 |
Source | Human adult brain |
Rouge ID |
mKIAA0628
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 155 | 178 | PD000003 | Zinc finger |
IPR007087 | 183 | 206 | PD000003 | Zinc finger | |
IPR007087 | 211 | 234 | PD000003 | Zinc finger | |
IPR007087 | 239 | 262 | PD000003 | Zinc finger | |
IPR007087 | 267 | 290 | PD000003 | Zinc finger | |
IPR007087 | 295 | 318 | PD000003 | Zinc finger | |
IPR007087 | 323 | 346 | PD000003 | Zinc finger | |
IPR007087 | 351 | 374 | PD000003 | Zinc finger | |
IPR007087 | 379 | 402 | PD000003 | Zinc finger | |
IPR007087 | 407 | 430 | PD000003 | Zinc finger | |
IPR007087 | 435 | 458 | PD000003 | Zinc finger | |
IPR007087 | 463 | 486 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 127 | 149 | PF00096 | Zinc finger |
IPR007087 | 155 | 177 | PF00096 | Zinc finger | |
IPR007087 | 183 | 205 | PF00096 | Zinc finger | |
IPR007087 | 211 | 233 | PF00096 | Zinc finger | |
IPR007087 | 239 | 261 | PF00096 | Zinc finger | |
IPR007087 | 267 | 289 | PF00096 | Zinc finger | |
IPR007087 | 295 | 317 | PF00096 | Zinc finger | |
IPR007087 | 323 | 345 | PF00096 | Zinc finger | |
IPR007087 | 351 | 373 | PF00096 | Zinc finger | |
IPR007087 | 379 | 401 | PF00096 | Zinc finger | |
IPR007087 | 407 | 429 | PF00096 | Zinc finger | |
IPR007087 | 435 | 457 | PF00096 | Zinc finger | |
IPR007087 | 463 | 485 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 127 | 149 | SM00355 | Zinc finger |
IPR015880 | 155 | 177 | SM00355 | Zinc finger | |
IPR015880 | 183 | 205 | SM00355 | Zinc finger | |
IPR015880 | 211 | 233 | SM00355 | Zinc finger | |
IPR015880 | 239 | 261 | SM00355 | Zinc finger | |
IPR015880 | 267 | 289 | SM00355 | Zinc finger | |
IPR015880 | 295 | 317 | SM00355 | Zinc finger | |
IPR015880 | 323 | 345 | SM00355 | Zinc finger | |
IPR015880 | 351 | 373 | SM00355 | Zinc finger | |
IPR015880 | 379 | 401 | SM00355 | Zinc finger | |
IPR015880 | 407 | 429 | SM00355 | Zinc finger | |
IPR015880 | 435 | 457 | SM00355 | Zinc finger | |
IPR015880 | 463 | 485 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 127 | 154 | PS50157 | Zinc finger |
IPR007087 | 155 | 182 | PS50157 | Zinc finger | |
IPR007087 | 183 | 210 | PS50157 | Zinc finger | |
IPR007087 | 211 | 238 | PS50157 | Zinc finger | |
IPR007087 | 239 | 266 | PS50157 | Zinc finger | |
IPR007087 | 267 | 294 | PS50157 | Zinc finger | |
IPR007087 | 295 | 322 | PS50157 | Zinc finger | |
IPR007087 | 323 | 350 | PS50157 | Zinc finger | |
IPR007087 | 351 | 378 | PS50157 | Zinc finger | |
IPR007087 | 379 | 406 | PS50157 | Zinc finger | |
IPR007087 | 407 | 434 | PS50157 | Zinc finger | |
IPR007087 | 435 | 462 | PS50157 | Zinc finger | |
IPR007087 | 463 | 490 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 129 | 149 | PS00028 | Zinc finger |
IPR007087 | 157 | 177 | PS00028 | Zinc finger | |
IPR007087 | 185 | 205 | PS00028 | Zinc finger | |
IPR007087 | 213 | 233 | PS00028 | Zinc finger | |
IPR007087 | 241 | 261 | PS00028 | Zinc finger | |
IPR007087 | 269 | 289 | PS00028 | Zinc finger | |
IPR007087 | 297 | 317 | PS00028 | Zinc finger | |
IPR007087 | 325 | 345 | PS00028 | Zinc finger | |
IPR007087 | 353 | 373 | PS00028 | Zinc finger | |
IPR007087 | 381 | 401 | PS00028 | Zinc finger | |
IPR007087 | 409 | 429 | PS00028 | Zinc finger | |
IPR007087 | 437 | 457 | PS00028 | Zinc finger | |
IPR007087 | 465 | 485 | PS00028 | Zinc finger |
RT-PCR |
---|
RT-PCR-ELISA |
Primer_f | ATCCACTCTAGCCTCCTTATG |
---|---|
Primer_r | TGAGTCAACAATAAGCATCCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATCCACTCTAGCCTCCTTATG |
Primer_r | TGAGTCAACAATAAGCATCCC |
PCR product length | 158 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |