KIAA0383

Product ID	ORK00523
Accession No	AB002381
Description	K(lysine) acetyltransferase 6B, transcript variant 3
Clone name	hh00708s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1115) was subcloned upstream of the cDNA (1116-6592). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGCC GCGAATTCAC TAGTGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6592 bp) Predicted protein sequence (1781 aa)
HaloTag ORF Clone	FHC00523
Flexi ORF Clone	FXC00523
Source	Human adult brain
Rouge ID	mKIAA0383 by Kazusa Mouse cDNA Project
Note	We replaced hh00708, former representative clones for KIAA0383 with hh00708s1. (2002/5/10)

Length: 6592 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1246 bp
Genome contig ID	gi89161187f_76172622
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTTAACATAAAATAAATTATGATGAGCCATTTTT
Flanking genome sequence (289436 - 289485)	----+--------+--------+--------+--------+----* AGCCTCTTGTGTCCTGTCATATTATGATTGATAGAGAATGACCAATGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	76272622	76462056	16	100.0	Perfect prediction

Length: 1781 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW54558	99.9	MYST histone ac...	Homo sapiens
Q8WML3	98.2	Histone acetylt...	Macaca fascicularis
AAF00100	85.9	histone acetylt...	Homo sapiens
AAI50619	85.8	MYST histone ac...	Homo sapiens
Q8WYB5	85.9	Histone acetylt...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	215	272	PF00628	Zinc finger
	IPR001965	274	320	PF00628	Zinc finger
	IPR002717	481	668	PF01853	MOZ/SAS-like protein
HMMSmart	IPR005818	93	170	SM00526	Histone H1/H5
	IPR001965	215	270	SM00249	Zinc finger
	IPR001965	271	318	SM00249	Zinc finger
ProfileScan	IPR001965	213	272	PS50016	Zinc finger
ProfileScan	IPR001965	269	320	PS50016	Zinc finger
ScanRegExp	IPR001965	237	317	PS01359	Zinc finger

Primer_f	GATTACGCCTCTCCTGCTTGG
Primer_r	GTGTCTGTTTATATTGCTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GATTACGCCTCTCCTGCTTGG
Primer_r	GTGTCTGTTTATATTGCTTCC
PCR product length	83 bp
PCR conditions	95 °C15 sec64 °C60 sec32 cycles