KIAA0551

Product ID	ORK01090
Accession No	AB011123
Description	TRAF2 and NCK interacting kinase, transcript variant 1
Clone name	hh00867s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5727 bp) Predicted protein sequence (1385 aa)
HaloTag ORF Clone	FHC01090
Flexi ORF Clone	FXC01090
Source	Human adult brain
Rouge ID	mKIAA0551 by Kazusa Mouse cDNA Project
Note	We replaced hh00867, former representative clones for KIAA0551 with hh00867s1. (2002/5/10)

Length: 5727 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1378 bp
Genome contig ID	gi89161205r_172162986
PolyA signal sequence (TATAAA,-31)	+--------+--------+----*----+---- TCCTTATAAACTCTTACTCAAATGATTTGAACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATGCGACTGGGATTTTTTTTTTCCAAAGCTACAAGCATGGCCGCCTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	172262986	172660812	33	99.8	Perfect prediction

Length: 1385 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKE5	100.0	TRAF2 and NCK-i...	Homo sapiens
XP_001164831	99.9	TRAF2 and NCK i...	Pan troglodytes
XP_001088063	99.9	TRAF2 and NCK i...	Macaca mulatta
AAF03785	99.4	Traf2 and NCK i...	Homo sapiens
XP_001492832	98.8	similar to TRAF...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014587	6.3e-43	63.8	KIAA0687
D86959	1.4e-13	26.7	KIAA0204
AB037782	3.2e-10	30.9	KIAA1361
AB020688	2.9e-09	32.5	KIAA0881
AB032968	2.6e-08	38.6	KIAA1142

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	50	313	PD000001	Protein kinase
HMMPfam	IPR000719	50	314	PF00069	Protein kinase
HMMPfam	IPR001180	1072	1363	PF00780	Citron-like
HMMSmart	IPR001245	50	314	SM00219	Tyrosine protein kinase
	IPR002290	50	314	SM00220	Serine/threonine protein kinase
	IPR001180	1067	1365	SM00036	Citron-like
ProfileScan	IPR000719	50	314	PS50011	Protein kinase
ScanRegExp	IPR000719	56	79	PS00107	Protein kinase
ScanRegExp	IPR008271	174	186	PS00108	Serine/threonine protein kinase

Primer_f	GTATGTTGGGTAATTTGGAGG
Primer_r	TCCTGTGTTCTCCCTGTGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTATGTTGGGTAATTTGGAGG
Primer_r	TCCTGTGTTCTCCCTGTGTGG
PCR product length	193 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles